| . |
DNA Sequencing Module
(to download in PDF or Word format, visit the download
page)
Table of Contents
Introduction
-A Genetic Basis for Nicotine Addiction
-How Do We Sequence DNA? An Overview
-References
Experimental Procedure
-Day 1: DNA Sequencing by Thermal Cycling
-Day 2: Gel Electrophoresis
-Day 3: Detecting the DNA
-Day 4: Data Analysis
-Day 5: BLAST Search and DNA Assembly
Student Activities
-Questions
-Modeling DNA Sequencing with Pop-It Beads
-Modeling the Assembly of DNA Fragments
-Finding Open Reading Frames
Teacher Resource
Appendices
Appendix 1 - Equipment and Supplies, Solutions
Appendix 2 - How to Submit Student Data
Appendix 3 - Automated Sequencing Protocol & Reagents
A GENETIC BASIS FOR NICOTINE ADDICTION
ABSTRACT
The abuse of psychoactive drugs (i.e. drugs that affect the brain), particularly tobacco and alcohol, is a major health problem in the United States. The 2000 Monitoring the Future Study, which surveyed drug use among high school students across the USA, reported the following extent of lifetime drug use among 12th graders: alcohol: 81%, cigarettes: 65%, marijuana: 49%, inhalants: 14%, LSD: 11%, and cocaine: 9% (National Institute on Drug Abuse web site: http://www.nida.nih.gov/Infofax/HSYouthtrends.html). According to the Surgeon General, tobacco smoking is the leading preventable cause of disease and death in the United States and accounts for nearly 20% of all deaths in developed countries. The teen years are a critical time for making choices about smoking, since 80% of all smokers begin when they are teens.
Knowing the potentially deadly affects of psychoactive drugs, why do some people persist in using them? The answer, in part, is that their bodies have become addicted to a particular drug, so that quitting causes psychological and/or physical discomfort. Because of the important role of addiction in reinforcing drug use, understanding the processes that lead to drug addiction is a major focus of scientific research.
As part of the StarNet project, high school students are sequencing genes related to nicotine addiction. Beginning in 2001, students are characterizing variation in the gene called CYP2A6, which codes for an enzyme involved in the excretion of nicotine. The student project has the potential for identifying new variants of this gene and ultimately contributing to our understanding of nicotine addition.
BACKGROUND
What is genetic variation and how is it related to drug addiction? Each of us is strongly aware of how we are different from everyone else—our own uniqueness. People come in all different shapes, sizes, and colors, with a wide range of abilities, talents, and personalities. We even vary in the way we respond to drugs. What determines our characteristics, or traits? Our traits are determined by a variety of factors, including genetics, our environment, and our culture.
An exciting revelation of the Human Genome Project is how similar all human beings are on the genetic level—we are all 99.9% the same! This means that a comparison of the DNA sequence of two individuals would reveal approximately one different nucleotide for every thousand nucleotides of sequence. Some of these nucleotide differences do not have any effect at all, while others change a particular genetic trait. In rare cases, differences in the nucleotide sequence can have extreme consequences for the individual, but usually they result in the subtle differences that make each of us unique.
An important area in genomic research is characterizing variation in genes that are related to potential health risks. For example, scientists are looking for genes that predispose people to a higher risk of heart disease, which is the leading cause of death in the USA. Research shows that there are both genetic and environmental factors that determine susceptibility to heart disease, and many genes are involved. By comparing gene sequences in people from families with high and low incidence of heart disease, scientists can build a picture of the genetic factors that make people more susceptible and address better ways to prevent or treat this condition. A similar approach is being applied to drug addiction.
Activity 1: Exploring genetic variation. Complete Activities 1 and 2 in the NIH curriculum supplement, Human Genetic Variation. Activity 1 will allow you to determine some of the genetic traits that make you different from your classmates, and in Activity 2 you will explore the effects of some examples of genetic variation.
What genes are involved in drug addiction? To address this topic, we need to answer the following questions:
A drug is any substance that causes a change in the body through its chemical actions. Under this very general definition, drugs include medications such as aspirin, antibiotics like penicillin, and even chemicals that are synthesized inside the body, like hormones.
In this discussion we will focus on drugs that are commonly abused and have the potential to be addictive. Drug abuse is defined as taking a drug for any reason other than a medical one. Common examples of drug abuse include taking drugs to get a feeling of euphoria (a high) and taking steroids to enhance athletic ability. Our study is concerned with the abuse of psychoactive drugs.
Commonly abused psychoactive drugs include legal substances like alcohol and nicotine and illegal substances like marijuana, cocaine, LSD, and heroin. As well as causing a sensation of pleasure in the user, these drugs have the potential to be addictive. According to the National Institute on Drug Abuse, a drug is said to be addictive if it causes "uncontrollable compulsive drug seeking and use, even in the face of negative health and social consequences." Addiction results from both psychological and physiological dependence on the drug. Psychological dependence is characterized by constant craving for the drug, in spite of its detrimental effects. Physical dependence results in unpleasant symptoms when the drug is withheld, also known as withdrawal.
How do drugs of addiction interact with our bodies at the molecular level? Drugs of addiction exert their effect by interfering with a natural neural pathway in the brain called the reward pathway, which normally occurs in response to activities that promote survival, like eating and drinking. To understand how this works, we first need to consider the structure of nerve cells and how neurotransmission works.
There are billions of nerve cells, or neurons, in the brain. As shown in Figure 1, each neuron is made up of three parts: the central cell body, which directs the activity of the cell; dendrites, the short fibers extending from the cell body that receive messages from other neurons; and the axon, the single long fiber that extends from the cell body and transmits messages to other neurons or other tissues, like muscle.
Figure 1
. A neuron. (reproduced from National Institute on Drug Abuse Web Site. NIDA goes to school: Science-based drug abuse education. http://www.nida.nih.gov)
Neurotransmission is the process of transferring a message from the axon of one nerve cell, across a small space or synapse, to the dendrites of a nearby neuron. This message is transmitted via a chemical substance called a neurotransmitter. A message from a nerve body travels down its axon as an electrical impulse, triggering the release of a neurotransmitter at the end of the axon (Figure 2). The neurotransmitter crosses the synapse and binds to its specific receptor on the dendrites of the adjacent nerve cell. This results in either stimulation or inhibition of an electrical impulse in the receiving cell. The neurotransmitter is quickly inactivated, either through enzymatic breakdown or through re-uptake by transporter molecules located on the cell membrane of the axon that released it.
Figure 2.
A neural synapse. (reproduced from National Institute on Drug Abuse Web Site. NIDA goes to school: Science-based drug abuse education. http://www.nida.nih.gov)
Certain behaviors that are important for survival (e.g. eating) are reinforced by the body through the reward pathway. This occurs through the stimulation of a specialized set of neurons in the brain that create the sensation of pleasure in response to certain activities. One part of the reward pathway consists of specialized neurons in the ventral tegmental area (VTA) of the brain (just above the brain stem) that use the neurotransmitter, dopamine, to stimulate neurons in other parts of the brain. Stimulation of these neurons in the VTA results in an electrical impulse down the nerve axons. At the end of the nerve axons, vesicles containing dopamine fuse with the cell membrane, releasing dopamine into the synaptic cleft. The target cells at the cleft include nerve cells of the nucleus acumbens, a part of the emotional center of the brain (also called the limbic system), and neurons of the frontal region of the cerebral cortex. This pathway is called the mesolimbic dopaminergic system (Figure 3). After its release, dopamine is quickly reabsorbed by the cells that release it by a specialized pump called the dopamine transporter.
What are the molecular targets of common drugs of abuse? Nicotine, cocaine, alcohol, and amphetamines exert their addictive effects through the mesolimbic dopaminergic system. Although each of these drugs interacts with the brain in a different way, their overall effect is similar. They all increase the amount of dopamine in the synaptic clefts of the mesolimbic dopaminergic system. Nicotine mimics the neurotransmitter acetylcholine and binds to specific acetylcholine receptors on neurons in the ventral tegmental area of the brain (discussed in more detail later). When nicotine binds to these receptors, an electric impulse is sent down the nerve axon, resulting in the release of dopamine at the synapse. Through a different mechanism, alcohol also stimulates electric impulses down nerve axons, resulting in release of dopamine at nerve endings. In contrast, cocaine and amphetamines bind to the dopamine transporter on the nerve endings and block the re-uptake of dopamine, which results in the accumulation of dopamine in the synapse. An additional effect of amphetamines is that they bind to dopamine vesicles in the nerve endings and stimulate the release of dopamine into the synapse.
Figure 3
. The reward pathway in the brain. (reproduced from National Institute on Drug Abuse Web Site. NIDA goes to school: Science-based drug abuse education. http://www.nida.nih.gov)
Activity 2: Molecular mechanism of drugs of abuse. View the video, Animated Neuroscience and the Action of Nicotine, Cocaine, and Marijuana in the Brain.
How is genetic variation related to the understanding of drug addiction? Both research and everyday observation show that people react in different ways to drugs. For example, most of us know some people who struggle to quit smoking and start again frequently, and others who are able to quit "cold turkey." The act of giving up nicotine has a strikingly different effect on these two groups of people, causing strong withdrawal symptoms in the former, and having a much less severe effect on the latter. Is this difference genetic? In order to answer this question, researchers are sequencing genes implicated in addiction in many individuals and correlating their genotypes to their drug-taking profiles. Scientists decide which genes to study based on the known molecular mechanism of the drug. Based on what you have just read about the molecular targets of nicotine and cocaine, which genes might you consider good candidates for genetic susceptibility to these drugs?
A Closer Look at Genes Involved in Nicotine Addiction
In his search for genetic variation that correlates with smoking behavior, Dr. Carl Ton has studied several different genes, including the genes that code for the subunits that make up the nicotinic acetylcholine receptor and the CYP2A6 gene, which codes for an enzyme required for clearing nicotine from our bodies. Our current StarNet project is analyzing genetic variation in the CYP2A6 gene.
The nicotinic acetylcholine receptor. When cigarette smoke is inhaled, the nicotine in the smoke is absorbed into the systemic circulation, reaching the brain within 8 seconds of the first puff. Once in the brain, nicotine binds to receptors located on the cell bodies of neurons in the ventral tegmental area, as well as the terminals of these neurons, which are situated in the nucleus accumbens. Normally these receptors, called nicotinic acetylcholine receptors, bind the neural transmitter acetylcholine (shown in Figure 4). Nicotine is able to bind in place of acetylcholine on its receptor.

Figure 4. Structures of acetylcholine and nicotine.
The nicotinic acetylcholine receptor is a transmembrane protein made up of five subunits (shown in Figure 5). The binding of either nicotine or acetylcholine to the receptor results in the transient opening of a cation-specific pore in the receptor, allowing cations to move into the neuron. This results in an electrical impulse down the nerve axon, which leads to the release of dopamine in the nucleus accumbens and the prefontal cortex, creating a sensation of pleasure.
|
|
Figure 5.
Side view of the nicotinic acetylcholine receptor.The CYP2A6 gene. Our livers produce a family of enzymes called the the cytochrome P450s. These enzymes are involved in the detoxification of fat-soluble molecules like certain by-products of metabolism, steroids, and drugs that would otherwise accumulate in the body. The cytochrome P450s carry out a series of chemical reactions that make these molecules water soluble so that the body can excrete them in the urine. One member of this family, called CYP2A6, converts nicotine to a chemical called cotinine, which is further modified by other enzymes and then excreted. This enzyme is the product of the CYP2A6 gene.
Several different variations of the CYP2A6 gene have already been identified (reviewed by Oscarson, 2001). These include single nucleotide mutations, deletions, and amplifications. The normal form of this gene codes for an active form of the CYP2A6 enzyme. One of the first variations to be identified consists of a single nucleotide change. The enzyme coded by this variant has the amino acid histidine instead of leucine at position 160, and the enzyme is unstable and inactive. Several alleles in which the CYP2A6 gene has been deleted have also been identified, and these result in reduced or no enzyme being produced, depending on whether the individual has one or no copies of the CYP2A6 gene. One example of gene duplication has also been identified, and this results in increased enzyme production.
Is there a correlation between which two alleles of this gene people have (and thus how much of the CYP2A6 enzyme their bodies produce) and their smoking behavior? Several studies have shown that there is. Pianezza et al. (1998) demonstrated that people who make less CYP2A6 enzyme are less likely to be tobacco-dependent smokers. Smokers with reduced CYP2A6 enzyme smoke significantly fewer cigarettes per day than people with normal levels of this enzyme. In a later study, they confirmed this result and showed that people who have a duplication of the gene in one of their alleles (and thus make more CYP2A6 enzyme) are heavier smokers than those who have two normal alleles (Rao et al, 2000). In contrast, other studies have found no correlation between the amount of the CYP2A6 enzyme produced and smoking behavior.
A correlation has also been shown between amount of the CYP2A6 enzyme produced and lung cancer. The CYP2A6 enzyme converts precarcinogenic compounds in tobacco smoke called nitrosamines to carcinogens. A study that analyzed the CYP2A6 genes of individuals with lung cancer showed that lung cancer patients were less likely to have two copies of the deletion allele than were healthy subjects (Myamoto et al, 1999). Thus, making less CYP2A6 enzyme results in a decreased risk for lung cancer. This may be due to the fact that these people are less likely to smoke or smoke fewer cigarettes than people with two normal alleles, or it may be due to the lower level of carcinogens in their bodies. These findings are exciting because they suggest that it might be possible to help smokers quit smoking by inhibiting their CYP2A6 enzyme.
Our student sequencing project is focused on characterizing sequence variation in the CYP2A6 gene among eight different individuals. Our eight subjects are part of the Human Polymorphism Discovery Panel, which is a panel of human subjects assembled by scientists at the National Institutes of Health for studying genetic polymorphisms. These individuals have provided their informed consent for use in genetic variation studies, and their identities are kept anonymous. The eight individuals in our study represent the many different ethnicities that make up the population of the USA, and thus it is quite likely that we’ll identify some genetic differences . Within this population, we may find polymorphisms that have already been identified, and we may discover new ones.
CYP2A6 is located on Chromosome 19 at position 19q13.2 (see Figure 6a). It occurs in a cluster of CYP2A genes that includes CYP2A7 and CYP2A13, as well as two CYP2A pseudogenes. The CYP2A genes all have nine exons and almost the identical DNA sequence. This can make it very difficult to distinguish them experimentally, and it has led to some contradictory results in the literature.
Figure 6a. Chromosomal location of the CYP2A family of genes (not available on web).
How We Make DNA Sequencing Templates Across the CYP2A6 Gene
The DNA templates used by students are made by the two-step PCR process shown in Figure 6b. First we use PCR to amplify a big chunk (2000-3000 nucleotides) of the CYP2A6 gene, using PCR primers that are very specific for CYP2A6 and do not match CYP2A7, CYP2A13, or any other region in genome. Then we dilute this primary PCR product and use it as our DNA template in a secondary PCR reaction. In the second reaction, we use PCR primers that are about 200 nucleotides apart so that we make a DNA fragment that is about the right size for DNA sequencing. The secondary PCR primers each have an extra non-human DNA sequence on their 5’ ends that will bind to one of two different DNA sequencing primers (referred to as the sequencing primer binding sites). This will allow us to sequence our PCR products from both ends and hopefully meet in the middle. During the second PCR reaction we do not need to worry about amplifying the wrong gene because we will already have selected the gene we want in the first reaction.
Figure 6b. PCR amplification of CYP2A6 Gene (not available on web).
DNA Sequencing - Introduction
Review of DNA Structure and its Synthesis
DNA is the information molecule of the cell. All living organisms use a substance called DNA (deoxyribonucleic acid) to store the information needed to direct the development, growth, maintenance and propagation of the organism. We are all familiar with the structure of DNA, consisting of two long chains or strands that wind around each other in the formation known as the double helix. How can such a simple structure account for the incredible diversity of life on earth? The answer lies in the nucleotides, or subunits, that make up the strands. There are four nucleotides in DNA, called A, C, G and T (adenine, cytosine, guanine and thymine), and it is the order of these four nucleotides in the DNA that provides the blueprint or code for an organism.
Like any code, that of DNA needs to be translated into a different language. Most of the information contained in a DNA molecule is used to direct the synthesis of a second type of molecules called proteins. Like DNA, proteins are composed of subunits that are linked into long chains. Protein subunits are called amino acids, and there are twenty of them. Unlike DNA chains, protein chains fold into complex three dimensional structures that enable them to function in a variety of ways inside the cell. Some proteins are important components of structures like cell membranes, muscles, skin and bone. Other proteins, called enzymes, act like machines that bring about the chemical reactions needed for cell survival. Still others, such as hormones, are messengers that control cell growth and development. Thus, as shown on the next page, the simple linear structure of DNA carries the code for the formation of complex three-dimensional proteins that give the cell structure, carry out chemical reactions and act as messengers within and between cells. In many ways this is analogous to a computer, which is able to carry out many complex functions using a simple binary code.
Figure 6 not available on web.
The structure of DNA provides a way for it to be copied. Every time a cell divides, the DNA is first copied by a process called DNA replication or DNA synthesis. How DNA is synthesized is extremely simple to understand when you know about DNA structure, so let's discuss start by discussing the structure of DNA.

Figure 7. Structure of a deoxynucleotide.
We have already mentioned that DNA is a double helix consisting of two interwound chains of building blocks called nucleotides. The four nucleotides, A, C, G and T, consist of three parts (shown in Figure 7): 1) A five carbon sugar ring (called deoxyribose). For convenience, the five carbons in the sugar ring are referred to as the 1', 2' 3', 4' and 5' carbons (pronounced one prime, two prime, etc.). 2) A nitrogenous base. This is attached to the 1'carbon on the sugar ring. 3) A triphosphate group, which is attached to the carbon that sticks out from the sugar ring (the 5' carbon). When nucleotides are incorporated into a DNA chain, the end two phosphates are released, so there is only one phosphate group. The four nucleotides have different nitrogenous bases, but otherwise they are the same.
Figure 8 shows a segment of a DNA double helix that has been flattened into the plane of the page. The nucleotides in each DNA strand are joined head to tail by covalent bonds that link the phosphate group on the 5' carbon of one nucleotide to the 3' carbon on the next nucleotide. The chain of alternating sugar rings and phosphate groups forms the sugar-phosphate backbone of the DNA strand. As you can see from Figure 8, the chain is directional because all the nucleotides are oriented so that their 3' carbons point in one direction (toward the 3' end of the chain) and their 5' carbons point in the other (to the 5' end of the chain). The two strands that make up a double helix are oriented so that their nucleotides face in opposite directions (we say they are antiparallel). The sugar-phosphate backbones of the two strands wrap around the outside, with the nitrogenous bases pointing to the inside. The bases from the two strands are paired in a very specific way, with A always matched with T and C matched with G. (We call the A-T and C-G pairs the complementary base pairs.) Hydrogen bonds between the base pairs hold the two chains together. Thus, knowing the order of the nucleotides in one DNA strand, we will also know the order of nucleotides in its matching or complementary strand.
Figure 8
. Structure of double-stranded DNA. The DNA helix is unwound and flattened in this view. Reproduced with permission from Campbell, Neil A. (1996) Biology. Redwood City, CA; The Benjamin Cummings Publishing Company, Incorporated.DNA synthesis inside a cell occurs in several stages. How does knowing the structure of DNA help us understand how it is synthesized? Since the nucleotides in the two strands are always matched, each strand should be able to act as a model or template to make the other strand. This is the basis for what happens when the two strands of the double helix are copied during DNA synthesis. The process occurs in three stages: initiation, elongation and termination. Each of these steps requires the activity of several proteins, and at least 20 proteins are involved altogether.
During initiation, the two strands of the double helix are separated at several specific sites by breaking the hydrogen bonds between the nucleotide pairs. Each of the strands then acts as a template from which a new DNA strand is copied. A primer, the place where DNA synthesis begins, is made on each exposed strand of DNA. The primer consists of a short chain of nucleotides that bind to the DNA template through base pairing. Many different proteins work together to carry out the steps of strand separation and primer formation.
During elongation, shown in Figure 9, a new strand of DNA is made by joining nucleotides together in the order that is complementary to the DNA template strand. This process is carried out by an enzyme called DNA polymerase (as well as several helper proteins). In the first step, a nucleotide is added onto one end of the primer. This nucleotide first binds to the DNA template next to the primer end by base pairing. Then DNA polymerase forms a covalent bond between OH group on the 3' carbon of the primer and the phosphate group on the incoming nucleotide. The newly added nucleotide now acts as the primer end, and the next nucleotide is added on to it. As the two DNA strands are copied, enzymes called helicases unzip the strands ahead of the DNA polymerase so that the nitrogenous bases are exposed. Nucleotides are added to each new DNA strand until the both of the template strands have been copied.
In fact, DNA synthesis is a little more complicated than this. Remember that the two strands of a double helix point in opposite directions, but DNA synthesis occurs in only one direction (from 5' to 3'). Because of this, there are a few differences in the way that DNA is copied on the two strands. If you are interested in learning more about this, please refer to one of the references listed in the introduction to DNA Sequencing (e.g. Alberts et al, Kreuzer and Massey or Campbell).
Termination is the finishing up process. Primers are removed and the resulting gaps are filled in with DNA and sealed. In higher organisms, a special kind of DNA synthesis occurs on the ends of the DNA. The result is two DNA helices that each contain one of the original DNA strands and one newly synthesized DNA strand.
Figure 9
. Addition of a nucleotide during DNA synthesis (elongation). A covalent bond is formed between the 3' OH on the primer end (labeled "New Strand") and the first phosphate on the 5' carbon of the incoming nucleotide. The other two phosphates are released into solution. Reproduced with permission from Campbell, Neil A. (1996) Biology. Redwood City, CA; The Benjamin Cummings Publishing Company, Incorporated.
DNA can be synthesized inside a test tube. How can we carry out this complex process inside a test tube? We usually focus on one part of the reaction, using just a few of the components that are required inside the cell. In the simplest system, like the one we'll use in this experiment, we duplicate the elongation step that is shown in Figure 9. This process needs the following components:
1. a piece of DNA to act as a template;
2. a short complementary piece of DNA to be the primer (in Figure 9, the primer is the same as the short piece of DNA labeled "New Strand");
3. four deoxynucleotides (A, C, G, T);
4. DNA polymerase.
The DNA template can be any piece of DNA that we’re interested in copying. The primer is usually a short (18-25 nucleotide long) piece of DNA that is complementary to a portion of the DNA template. All four nucleotides are needed. The DNA polymerase can be any one of several commercially available polymerases. Which DNA polymerase is used depends on the kind of investigation being carried out. All of these components are mixed together in a tube under conditions that are optimal for the particular DNA polymerase being used (e.g. optimal salt conditions, pH, concentration for each component, and temperature). When incubated at the temperature that is ideal for the DNA polymerase, a new DNA chain is made.
HOW DO WE SEQUENCE DNA? AN OVERVIEW
DNA sequencing is the process of figuring out the order of the nucleotides, or building blocks, in a DNA fragment. The most commonly used sequencing technique, developed in 1977 by Dr. Frederick Sanger, is called chain termination sequencing. This process utilizes the elongation step of DNA synthesis, which was discussed in the previous section. In this section we will discuss the four steps required to sequence DNA: DNA synthesis, gel electrophoresis, DNA dtection, and data analysis.
Step I. Using DNA Synthesis to Make DNA Fragments Terminating in Dideoxynucleotides
You have just reviewed the four components needed for DNA synthesis in vitro (a DNA template, primer, the four deoxynucleotides, and DNA polymerase). In addition, Sanger sequencing uses modified nucleotides called dideoxynucleotides. Dideoxynucleotides are identical to the deoxynucleotides normally used during DNA synthesis, except they lack the OH group on the 3' position of the ribose sugar (see Figure 10). During DNA synthesis, a dideoxynucleotide can be added to a growing DNA strand, but, because the 3’ OH is missing, the next nucleotide cannot be attached. For this reason, dideoxynucleotides are sometimes called chain terminators.

Figure 10
. Structure of a deoxynucleotide and a dideoxynucleotide. The arrows indicate the single difference in the structures of these two molecules.In the first step of this process, DNA synthesis is used to make thousands of partial copies of the DNA fragment being sequenced. Each of these partial copies terminates at a different position in the DNA sequence. The following components are needed:
Four different synthesis reactions are needed for each DNA template being sequenced. Each reaction contains the DNA template, DNA primer, deoxynucleotides, DNA polymerase, and one of the four dideoxynucleotides. As shown in Figure 11, synthesis starts at the site where the DNA primer anneals to the template (on the known sequence), and it extends into the unknown sequence. Nucleotides are added to each new DNA strand until a dideoxynucleotide is added, causing the chain to be terminated. Since each of the four reactions contains only one kind of dideoxynucleotide, all the newly made DNA fragments in each tube will terminate in one kind of dideoxynucleotide. In this way, four sets of DNA fragments are synthesized, all starting at the primer and terminating in either A, C, G or T. The length of each fragment is a measurement of the distance from the primer to one particular nucleotide on the DNA template.
Step II. Gel Electrophoresis
Now we need to separate all the DNA fragments according to their length. We need to be able to distinguish fragments that differ in length by just one nucleotide. For this purpose, we use a technique called gel electrophoresis, shown at the bottom of Figure 11.
The four termination mixtures are heated to denature the DNA (this separates the newly synthesized strands from the template strand). They are then loaded in adjacent lanes on the gel. An electric current is applied across the gel, and the samples are electrophoresed for several hours. This moves the negatively charged DNA fragments down the gel toward the positive electrode, with the smallest fragments migrating the fastest. DNA fragments that differ in length by one nucleotide will migrate to slightly different positions within the gel.
Step III. Detecting the DNA
Once the DNA fragments are separated, how will we see them? The primer we used has a biotin tag on its 5' end, and our staining process reacts specifically with this biotin tag, creating a blue band at the position of the DNA fragment. This will be discussed in more detail later.
Step IV. Data Analysis
How will we interpret the pattern of the DNA bands we see? Look at Figure 11. The top half of the figure shows the synthesis of four sets of DNA fragments that end in either A, C, G or T. As shown in the bottom half of the figure, four sets of fragments are separated in four separate lanes on a sequencing gel.
To read the sequence shown on the gel, start as close to the bottom of the gel as possible. Identify the lowest visible band on the gel. What lane is it in (A, C, G, or T)? The lane letter tells you what nucleotide this band represents. Now look across all four lanes and identify the band that is one step higher within the gel. What nucleotide is it? Continue up the gel, stepping up to the next highest band and writing down the lane it is in. Notice that the sequence you read is the complement of the DNA template.
Once you have read the short DNA sequence shown in the schematic gel in Figure 11, look at Figure 12, which shows a copy of a student gel. Try reading the sequence. As you proceed up the gel, you'll notice that the bands get closer together until finally you can't tell them apart. At this point you need to stop because you cannot accurately interpret the data. You should be able to read at least 100 nucleotides on the gel.

Figure 11
. DNA Sequencing Made Simple. The top part of this figure shows the four DNA synthesis reactions. The circles are the DNA templates (solid line is the known sequence, and the string of letters represents the unknown sequence). In each reaction, the newly synthesized fragments (i.e. the solid lines attached to the primer) end in either A, C, G, or T. In the bottom half of the figure, DNA fragments in the four reactions are separated by gel electrophoresis in four separate lanes. The smallest fragments migrate the fastest.
Activity 3: Complete the DNA sequencing simulation with pop-it beads described in the student activities section.
Activity 4: Before you begin the experiment, complete the activities called "Identifying Variants in the CYP2A6 Gene" and "Can a Single Nucleotide Change Affect the Protein that is Made?" in the student activities section.
Figure 12. Reading a DNA Sequencing Ladder. To read this DNA sequence, identify the lowest band in the pattern. What lane is it in? Look at the label at the bottom of the lane. If the lane is labeled "A", then this band corresponds to an "A" in the chain we are sequencing. Now move up the band pattern to the next lowest band. What lane is it in? This is the next base in our sequence. Read as far as you can up the band pattern. The arrow (I) indicates a position where bands of similar intensity appear in more than one lane. Use "N" at this position to indicate that you cannot determine the correct nucleotide.
REFERENCES
Alberts, Bruce, Dennis Bray, Julian Lewis, Martin Raff, Keith Roberts and James D.Watson (1994). Molecular Biology of the Cell. New York; Garland Publishing, Inc.
Balfour, D.J.K. (1994). Neural mechanisms underlying nicotine addiction. Addiction Vol. 89, pp. 1419-1423.
Benowitz, N.L. (1992). Cigarette Smoking and Nicotine Addiction. Medical Clinics of North America Vol. 76, pp. 415-437.
BSCS and Videodiscovery (2001). The brain: understanding neurobiology through the study of addiction. NIH Curriculum Supplement
Campbell, Neil A. (1996) Biology. Redwood City, CA; The Benjamin Cummings Publishing Company, Incorporated.
Curtis, Helena and N. Sue Barnes (1989) Biology. New York, NY; Worth Publishers, Inc.
Cooper, Necia Grant, ed. (1994) The Human Genome Project - Deciphering the Blueprint of Heredity. Mill Valley, CA; University Science Books.
Dani, J.A and S. Heinemann (1996). Molecular and Cellular Aspects of Nicotine Abuse. Neuron Vol. 16, pp.905-908.
Department of Health and Human Services, Public Health Service: The Health Consequences of Smoking: Nicotine Addiction. A Report of the Surgeon General. DHHS (CDC) Publication No. 88-8406. Washington, DC, US. Government Printing Office, 1988.
Kreuzer, Helen and Adrianne Massey (1996) Recombinant DNA and Biotechnology. Washington, D.C.; ASM Press.
Micklos, David A. and Greg A. Freyer (1990) DNA Science. Cold Spring Harbor, NY; Carolina Biological Supply Company and Cold Spring Harbor Press.
Miyamoto. M., Y. Umetsu, H. Dosaka-Akita, Y. Sawamura, J. Yokota, H. Kunitoh, N. Nemoto, K. Sato, N. Ariyoshi, T. Kamataki (1999). CYP2A6 gene deletion reduces susceptibility to lung cancer. Biochem. Biophys. Res. Commun. 261, pp658-660.
National Institute on Drug Abuse Web Site. NIDA goes to school: Science-based drug abuse education. http://www.nida.nih.gov
Nisell, M., G.G. Nomikos and T.H. Svensson (1995). Nicotine Dependence, Midbrain Dopamine Systems and Psychiatric Disorders. Pharmacology & Toxicology Vol. 76, pp. 157-162.
Oscarson, M. (2001). Genetic polymorphisms in the cytochrome P450 2A6 (CYP2A6) gene: implications for interindividual differences in nicotine metabolism. Drug Metabolism and Disposition Vol. 29, pp91-95.
Pianezza, M.L.: E.M. Sellers, R.F. Tyndale (1998). Nicotine metabolism defect reduces smoking. Nature Vol 393, p. 750.
Picciotto, M.R.,M. Zoli, R. Rimondini, C. Lena, L.M. Marubio, E.M. Pich, K. Fuxe, J.-P. Changeux (1998). Acetylcholine receptors containing the b 2 subunit are involved in the reinforcing properties of nicotine. Nature Vol. 39, pp. 173-177.
Rao, Y., E. Hoffman, M. Zia, L. Bodin, M. Zeman, E. Sellers, R. Tyndale (2000). Duplications and defects in the CYP2A6 gene: identification, genotyping, and in vivo effects on smoking. Molecular Pharmacology, Vol 58, pp. 747-755.
Washington State Department of Health web site (http://www.doh.gov/topics/ tobacco.htm)
Winternitz, Katherine A., et al. (1996) Biological Science:A Molecular Approach. BSCS Blue Version, 7th ed. Lexington, MA; D.C. Heath and Co.
DNA Sequencing: Experimental Procedure
Day 1: DNA Sequencing by Thermal Cycling
BACKGROUND
Cycle sequencing is very similar to a technique called the Polymerase Chain
Reaction (PCR). Like PCR, cycle sequencing uses a heat stable DNA polymerase
that functions at a high temperature and is resistant to near boiling
temperatures for many hours. This process has two main advantages over other
sequencing techniques. First, a lower concentration of DNA template can be used
because the template is reused during each cycle. (For this reason the primer is
often much more concentrated than the template.) Second, the high temperatures
help to 'melt out' secondary structure in the DNA template (like hairpins) that
could otherwise inhibit the DNA polymerase. It is also much easier!
Cycle sequencing is described below and is illustrated in Figure 13.
Step I. Make reaction mixtures
First, all of the components needed for DNA synthesis are mixed in a
tube: DNA template (the DNA molecule being sequenced), a DNA primer, the four
deoxynucleotides (dATP, dCTP, dGTP and dTTP), one dideoxynucleotide, reaction
buffer and the DNA polymerase. For each DNA template being sequenced, we need to
prepare four samples, each containing one of the four dideoxynucleotides (ddATP,
ddCTP, ddGTP, or ddTTP).
To make sample preparation easy, all of the components except the DNA template are pre-mixed. All you need to do is put some of the four different reaction mixes (A, C, G or T mix) in four different tubes and add your DNA template to each tube. See Step I in Figure 13.
Step II. Perform DNA synthesis
DNA synthesis is carried out by incubating these four samples at three
different temperatures. Look at Step II in Figure 10. The three panels at the
bottom show what is happening inside the tubes at each temperature. First, the
samples are heated to 95˚C to break apart hydrogen bonds in the DNA
(i.e. base pairing is disrupted). Then the samples are cooled to 45-50˚C
to allow the primer to base pair, or anneal, to the DNA template. Finally, the
reactions are switched to 70-72˚C, the optimum temperature for the
DNA polymerase, and DNA synthesis occurs. After 1 minute at 70˚C, the
samples are cycled through the same three temperatures again, allowing another
round of DNA synthesis to occur. The DNA templates are re-used during each cycle
because the 95˚C incubation releases the template strands from the newly
synthesized DNA strands, making them available to be copied again. Typically we
carry out 10-20 cycles.
Step III. Stop DNA synthesis
At the end of the last cycle, the four samples are cooled to 4˚C
and mixed with sample loading dye.
Figure 13.
DNA sequencing by thermal cycling (not available on web).PROCEDURE
Teacher Directions
Preparation of A, C, G, T reaction mixtures with enzyme:
Thaw one aliquot each of the A, C, G, T reaction mixtures without enzyme (45 m L each). Add 5 m L DNA polymerase (3.8 units/m L ThermoSequenaseTM DNA polymerase containing thermostable pyrophosphatase). Pipet gently to mix. Make eight 4 m L aliquots of each reaction mix in the appropriate colored 0.5 mL tubes (see below for color code).
Student Directions
Check off each step as you complete it.
Pre-experiment preparation.
_____ Write down your lab group number, class letter, and DNA template number.
_____ Review the operation of the P-20 Micropipet, practicing with colored water if so instructed. Proficient micropipetting is essential to achieving reliable data!
*Note: If you are performing the thermal cycling manually, make sure that the
temperatures in your three water baths are 95°C, 45-50°C, and 70-72°C respectively.
Step I. Make reaction mixtures
__A. Label the top of four 0.5 ml tubes with your class letter and
lab number. We’ll use color-coded tubes: A is clear.
C is blue.
G is yellow.
T is pink.
__B. Put the following in each tube:
|
A tube (clear) |
C tube (blue) |
G tube (yellow) |
T tube (red) |
|
|
Reaction Mix (A,C,G or T) |
8 µL |
8 µL |
8 µL |
8 µL |
|
DNA Template |
4 µL |
4 µL |
4 µL |
4 µL |
|
TOTAL |
12 µL |
12 µL |
12 µL |
12 µL |
__C. Close the lids and spin in the centrifuge for a few seconds.
Step II. DNA synthesis by manual thermal cycling
__A
. You are going to carry out thermal cycling by manually moving your sample tubes between three water baths set at 95° C, 45-50° C, and 70-72° C. Before starting, make sure the water in each bath is deep enough that it covers the sides of the sample tubes when they are sitting in the sample rack. You may need to partially cover the bath with foil to maintain a constant temperature.__B. Make sure your four sample tubes are clearly labeled and place them in one of the two metal thermal cycling racks. When everyone’s samples have been loaded into the racks, screw on the metal lid.
__C. It takes three people to carry out the thermal cycling. Each lab group should take a turn doing at least one cycle.
Person 1 is the cycler, and moves the racks from one water bath to the next.
Person 2 is the timekeeper. Following the chart below, tell the cycler when to move the racks and check off each step on the chart as you complete it.
Person 3 watches the temperature and level of each water bath, adjusting the thermostat slightly and adding small amounts of water as needed.
|
Cycle # |
95° C |
Check |
45-50° C |
Check |
70-72° C |
Check |
|
0 |
1 min |
-- |
-- |
|||
|
1 |
30 sec |
30 sec |
1 min |
|||
|
2 |
30 sec |
30 sec |
1 min |
|||
|
3 |
30 sec |
30 sec |
1 min |
|||
|
4 |
30 sec |
30 sec |
1 min |
|||
|
5 |
30 sec |
30 sec |
1 min |
|||
|
6 |
30 sec |
30 sec |
1 min |
|||
|
7 |
30 sec |
30 sec |
1 min |
|||
|
8 |
30 sec |
30 sec |
1 min |
|||
|
9 |
30 sec |
30 sec |
1 min |
|||
|
10 |
30 sec |
30 sec |
1 min |
Step III. Stop DNA synthesis
__A. Pick up your team’s tubes from the class rack.
__B. Spin samples briefly.
__C. Add 10 µL Stop Mix to each tube and mix well by pipetting.
__D. Rewrite the labels on any tubes if necessary.
__E. Place all your tubes in the tube rack for your class. Place the rack in a –20°C freezer until you are ready to load the gel.
Dispose of used micropipet tips in a biohazard bag.
DNA Sequencing- Experimental Procedure
Day 2: Gel Electrophoresis
BACKGROUND
Gel electrophoresis is a method of separating charged molecules, especially
large biomolecules like proteins, RNA, and DNA. The process is carried out in a
slab of gel that acts like a sieve. The gel is placed in a buffered solution,
and direct electric current is passed through it. This causes charged samples
embedded in the gel to be pushed through the gel. The direction that a
sample migrates depends on its net charge (either positive or negative) in the
buffer being used. How far the sample migrates depends on its total
charge, size and shape. The distance migrated is also affected by the conditions
used for electrophoresis, such as the voltage, the ionic strength and pH of the
running buffer, the temperature, the type of gel material used and the total
electrophoresis time.
Two types of gel materials are routinely used for studying DNA molecules: agarose and polyacrylamide. Agarose gels are useful for analyzing DNA fragments that are 300 to hundreds of thousands of base pairs in length. Polyacrylamide is generally used for DNA fragments smaller than 300 base pairs, like the ones we will be analyzing in this experiment.
Polyacrylamide is made up of long linear chains of subunits called acrylamide. Chemical bridges between the chains form the polyacrylamide into an interwoven mesh. The gel is poured between two glass plates held apart by plastic spacers along the sides. The spacers are usually between 0.2 and 1 mm in thickness, and the gel has the same thickness. A special spacer with flat teeth like a comb is inserted into the top of the gel. After the gel has set, the comb is removed, leaving wells along the top edge of the gel where the DNA samples will be loaded.
The pre-poured sequencing gel is placed in the apparatus shown in Figure 14 (full and side views). Notice that the upper buffer chamber extends over the entire area of the bonded gel plate, contacting the top of the gel near the fill spout. The upper buffer acts as a heat sink that maintains uniform heat distribution over the entire gel area during electrophoresis. The plate/buffer chamber unit is called the IPC (integral plate/chamber). The IPC sits in the lower buffer chamber at the base, held in place by a stabilizer bar. Both buffer chambers are protected by safety covers with attached electric cables. When the safety covers are in place, the cables contact the electrodes on the upper and lower buffer chambers. The other end of each electric cable is plugged into the power supply.
The electric current applied across the gel pulls the negatively charged DNA fragments out of the wells and down the gel toward the positive electrode.
We need to run our gels under conditions that separate DNA fragments differing in length by only one nucleotide. Several tricks are used to achieve this high level resolution. First, the gels are always made of polyacrylamide because it forms a finer sieve than agarose. The gels are typically longer and thinner than agarose gels to give better separation. Several features keep the DNA denatured during electrophoresis, including the use of 8M urea in the gel mixture, running the gel at high voltage to create heat in the gel, and the heating of samples prior to loading.


Figure 14
. Photo and side view of sequencing gel apparatus.
Figure 15
. Denaturing gel electrophoresis.
Prior to being loaded on the gel, the DNA samples (which contain a denaturing compound called formamide) are heated to 95°C (followed by quick cooling on ice) to bring about strand separation (see Figure 15). During the gel run, the DNA is kept in the denatured form by the high salt concentration in the gel (8 M urea), and by the high temperature of the gel (about 50°C, achieved by running the gel at high voltage). After electrophoresis, the gel is removed from the electrophoresis apparatus and is disassembled. The glass plates are separated, exposing the gel. A nylon membrane that looks like a very delicate paper is laid on top of the gel. This membrane binds DNA very well, so the DNA in the gel is adsorbed onto its surface. This step is necessary because it is difficult to stain the DNA while it is embedded in the gel.
Sequencing gels are much longer than typical gels (about 40-50 cm in length, compared to 6-10 cm for most gels). This allows the fragments to be spread out over a longer distance. Clear, sharp bands are achieved by using gels that are thinner than normal (about 0.2-0.4 mm thick, instead of 0.5-1.0 mm).
PROCEDURE
Check off each step as you complete it.
*NOTE: It is important that you wear lab gloves for this day’s activities.
Pre-Experiment Set-Up
The sequencing gel has been set up in the gel apparatus and pre-run at 2200 V by the classroom teacher or the visiting scientist about one hour before class to bring the gel temperature near 50°C.
Safety Note: Be sure that the lower buffer chamber is not over-filled. The level of the TBE running buffer in the base should be no higher than about 1 cm above the bottom edge of the black side clamps (500-600 mL).
Step I. Preparing and Loading the Samples
__A. To denature the DNA samples, place your four termination mixture tubes in a floating rack and set in the 95°C frying pan of water for 3 minutes. Then place the samples in an ice-water bath to quick cool the DNA. Quick cooling prevents the newly synthesized DNA from reannealing with the template DNA.
__B. Turn off the power supply, and remove the upper safety cover.
__C. Prepare your lanes for loading. The first group to load should start in the second or third lane from the left side of the gel. Mark the positions of your four lanes on the outer plate with a felt-tip pen (label lanes A, C, G, T and write your group number below). Use the transfer pipet to rinse your lanes just before loading your samples (to flush out dissolved urea).
__D. Using the P-20 and the flat-tipped microcapillary tips, load 5 µl of each sample in alphabetical order (A, C, G, T). To load, slowly suck your sample into the pipet tip, then lower the tip into the well by dragging the flat side of the tip down the back side of the front plate of the gel. Once the tip is in the well (just above the bottom of the well), slowly press down on the plunger of the pipettor so the sample forms a layer on the bottom of the well. Stop before you have loaded all of the sample (i.e. leave about 1 m L in the tip) and remove the tip from the well. THEN remove your thumb from the plunger.
__E. When all four samples are loaded, replace the upper safety cover, and turn on the power supply until both blue dyes have entered the gel (1-2 minutes).
__F. Repeat step A to E for each lab group. Heat your samples while the group ahead of you is loading theirs. Each group should leave a space of one lane between its samples and those of the previous group.
Note: Sample loading is the key to high-resolution gels. Your four wells must be cleaned immediately before loading your samples (i.e. rinse all four wells at once and then load the samples). The samples must be placed directly on top of the acrylamide gel. Load the gel as quickly as possible so the gel does not cool down.
Step II. Running the Gel
__A. Place the safety cover on the top of the gel, making sure that the electrodes fit into the plugs on the cover. Turn on the power supply to 2200 volts. Verify that current is flowing (note bubbles forming at the cathode wires in the IPC) and that all electrical connections are solid.
For best results, run sequencing gels at 50-55° C, using the temperature indicator strip on the outer gel plate to monitor the running temperature. As the gel runs, it will continue to heat up, and the voltage will need to be adjusted down to about 1800 volts. If the temperature goes above 60°C, the acrylamide/urea gel will start to hydrolyze rapidly, and the plates may crack.
Caution: Periodically inspect the level of the buffer in the upper chamber to make sure that it is above the minimum level.
__B. Run the gel until the xylene cyanol dye (the slower-moving turquoise colored dye) has migrated 3/4 the length of the gel (to the position of the spigot on the back plate).
__C. Occasionally during the run mark the left and right edges of the dyes corresponding to each set of samples. This will help you position the membrane later in this experiment.
Step III. Disassembling the Gel
__A. Turn off the power supply, disconnect both safety covers, pull out the stabilizer bar, and remove the IPC assembly.
__B. Carefully pour the upper buffer out of the IPC assembly into the lower buffer chamber or a nearby sink.
__C. Lay the IPC on the bench top, outer plate up. Using a ruler, draw vertical lines along the pen marks that bracket the lanes from each lab group.
__D. Now, turn the IPC over so that the outer plate faces down. Remove the side clamps from the IPC. Your teacher will carefully remove the inner glass plate with the attached buffer chamber by prying gently at the top of the gel, using a metal spatula. The gel should stick only to the outer (front) plate, as the inner plate was specially treated. Remove the spacers along the sides of the gel.
Step IV. Blotting Procedure
__A. Each lab group is provided a nylon membrane that is cut to the size of their portion of the gel. Handle the membrane by its edges only, using clean forceps and wearing gloves. Use a pencil to clearly label the top edge of one side of the membrane with the data file name, as shown in Figure 16 below.
__B. Dip the membrane into a tray containing TBE buffer. Hold the wet membrane – pencil side down, membrane top oriented towards the top of the gel -- at both ends, directly above your lanes on the gel (and not a neighboring lab group’s). Before lowering your membrane onto the gel, check its position. You cannot reposition it once you have started to lay it down! Plan for the bottom edge of the membrane to be about four centimeters (2 inches) above the bottom of the gel; the membrane will not reach up to the top of the gel. Once the wet membrane appears to be properly positioned, let the middle "sag" and lower it onto the gel surface. When it touches, slowly lower both hands so that the membrane flows smoothly onto the gel without trapping air bubbles (see Figure 17).
If the membrane is wider than the portion of the gel you want to cover then lay it down so that it overlaps the membrane covering the adjacent lanes, BUT NOT THE NEIGHBORING LANES THAT ARE NOT YET COVERED IN MEMBRANE.
__C. Once all the membranes have been laid in place, cover the membranes with 2 sheets of Whatman paper and a Plexiglas plate. Then apply a weight of approximately 4 kg (8 textbooks).
__D. Leave for 40 minutes.
__E. Remove the weights, Plexiglas plate, and Whatman paper. Pull off the membrane from the gel, taking care not to pick up any gel. If some gel sticks to the membrane, lift it off using a metal spatula or squirt some TBE buffer on the membrane to loosen it.
__F. Place the membrane, DNA side up (pencil side up) on a piece of Whatman paper that has been dipped in TBE buffer. Place both of these in the UV crosslinker and close the door (make sure the paper does not cover the disk at the back of the crosslinker). Turn the power on, press "optimal crosslink," and then press "start." When the timer rings, remove the membranes and turn the power off. The exposure to ultraviolet light induces the formation of covalent bonds between DNA and the membrane.
__G. Store the membranes inside a folded piece of paper, out of the light, until you are ready to stain (will keep indefinitely).
__H. Rinse the gel plates to remove all acrylamide. Make sure that all the pieces of the gel assembly are returned to the gel storage box (two plates, two spacers, one comb and two side clamps).
Dispose of used micropipet tips and gloves in a biohazard bag.

Figure 17
. Position of membrane over sequencing gel.Day 3: Detecting the DNA
BACKGROUND
So far we have synthesized DNA, separated the different sized DNA fragments
on a polyacrylamide gel, and transferred it to a nylon membrane. Now we are
going to wash the nylon membrane in a series of different solutions that will
stain the newly synthesized DNA dark purple. The critical wash steps are
outlined in Figure 18 and explained in detail below:
The primer we used has a chemical tag on its 5' end called biotin. This staining technique reacts specifically with the biotin tag.
The membrane is washed in a solution containing a special molecule called streptavidin. Streptavidin binds to the biotin molecules on the 5' end of the DNA. Each molecule of streptavidin has four sites for binding biotin. Usually, one streptavidin binds to each biotin molecule, leaving three empty biotin binding sites on each streptavidin molecule. These sites will be important in a later step.
The membrane is washed in a solution containing an enzyme called alkaline phosphatase (AP). The AP is covalently linked to a biotin tag. These biotin-tagged AP molecules bind to the streptavidin molecules on the DNA.
The membrane is soaked in a special substrate that is broken down by the alkaline phosphatase enzyme. When alkaline phosphatase removes a phosphate group from this substrate, a purple precipitate is formed. This results in the formation of a purple band at the position of each biotin-tagged DNA band.
Why do we do all this when it would be so much easier to simply label the DNA primer with a purple tag in the first place? The answer is that no purple dye is intense enough to detect visually at the concentration of the DNA primer we use. However, one molecule of the alkaline phosphatase enzyme can react with thousands of substrate molecules, resulting in a great enhancement of the signal. Since we are restricted in how much DNA we can load on a gel, we use this elaborate technique to create a colored signal.
1. Transfer the DNA from the gel to a nylon membrane.
2. Bind streptavidin to the biotin-labeled DNA
3. Bind biotin-labeled alkaline phosphatase to the streptavidin.
4. Add the color substrate for the alkaline phosphatase (AP). This compound forms a purple precipitate where the AP removes the substrate’s phosphate group. This creates a purple band on the gel.
Figure 18. Staining the DNA.
PROCEDURE
*NOTE: Wear gloves for the entire blotting procedure, as some of the solutions may be harmful. Use forceps to handle the membrane, and only touch it at the edges.
Pre-Experiment Set-Up
In this lab period, you will wash your nylon membrane in a series of wash solutions. Table I lists all of these solutions and their compositions. Each solution needs to be prepared just a few minutes before you use it. Assign two people in your lab group to be in charge of preparing the wash solutions, and two people to shake the membrane while it is being washed.
The first wash…
__A. Place the nylon membrane, DNA side up (i.e. pencil mark up), in the tray. Pour the first solution listed in Table I into the blotting tray (30 ml Blocking Solution).
__B. Swirl the tray for the entire wash time listed in Table I, making sure that the solution covers the membrane.
__C. At the end of the wash time, pour the solution into a sink, using the forceps to hold the membrane in the bottom of the tray and touching the membrane near the edge only.
D. Repeat steps (A) – (C) for each of the washes outlined in Table I. Check off each row in the table after you have completed its wash.
Hints:
1) Do not let the membrane dry out between washes.
2) It will not harm the experiment if you wash a few minutes longer than the time indicated.
3) Rinse the graduated cylinders – NOT YOUR MEMBRANE - between use with distilled water.
Table I
|
Solution |
Composition |
Wash Time |
|
Blocking Solution |
30 ml Blocking Solution |
5 minutes with swirling |
|
Streptavidin Solution |
15 ml Blocking Solution |
5 minutes with swirling |
|
Wash Solution I |
150 ml Wash Solution I |
5 minutes with swirling |
|
Wash Solution I |
150 ml Wash Solution I |
5 minutes with swirling |
|
Biotin-tagged AP Solution |
15 ml Blocking Solution |
5 minutes with swirling |
|
Wash Solution II |
150 ml Wash Solution II |
5 minutes with swirling |
|
Wash Solution II |
150 ml Wash Solution II |
5 minutes with swirling |
|
Wash Solution II |
150 ml Wash Solution II |
5 minutes with swirling |
|
Color Solution * Do not rinse this solution off! |
50 ml Color Substrate Buffer |
1-16 hours in dark, covered, without swirling |
1
The stock concentration of biotin-tagged AP is 0.5 mg/ml in this experiment. It is sometimes provided at 0.38 mg/ml, in which case 20 µl should be used.__E. Once the membrane has been put in Color Solution, cover the tray with saran wrap, then foil, and put in a dark, LEVEL drawer or cupboard. Leave the tray to develop for 12-16 hours. Do not leave the membrane in this solution beyond 16 hours, or the background will become too dark.
__F. When the DNA bands are visible, pour off the Color Solution and pour on 50 ml Stop Solution. Rinse for a few minutes and then rinse twice with 100 ml distilled water.
__G. Place the membrane on a paper towel to dry. When dry, place the membrane in a plastic page protector and store out of the light to minimize fading. Use a small piece of scotch tape along one edge of the membrane to hold it in one place on the black paper inside the protector.
__H. Additional copies of the dried membrane can be made on a photocopier. Experiment with the intensity dial on the photocopier to get the best image.
Dispose of used micropipet tips and gloves in a biohazard bag.
Day 4: Data Analysis
You have now completed the technical portion of the experiment and are about to embark on the most important part, the analysis of your DNA sequencing data! As you examine your membrane, think about the many steps that went into completing the experiment. What was happening during DNA synthesis? What happened to these DNA fragments during gel electrophoresis? How did you detect the fragments? Even if your membrane does not look the way you expected, there is a lot to learn from it.
Remember as you complete your analysis that there is no "right answer in the back of the book". It’s up to you and your team members to do the best job possible. This is research!
PROCEDURE
__A. Each lab group should have its original, labeled nylon membrane (inside the plastic page protector), plus a photocopy of it for each lab member. The name of your data file should appear on every photocopy.
__B. Write the lane letter on the membrane’s page protector or photocopy at the bottom of each lane. (Although the lanes are usually loaded in the order A, C, G, and T, the order is sometimes different because of a mix-up during loading or because the gel sticks to the back plate instead of the front plate during the transfer to the nylon membrane.)
__C. Work in pairs, with one person reading the DNA sequence and the other person writing it down on the Data Record Sheet. To read the DNA sequence, start near the bottom of the membrane or photocopy. Mark your starting position on the photocopy or the membrane’s page protector, using a washable felt-tip pen to write on the plastic. Once the first person has read the sequence, switch roles and have the second person read while the first person compares to what is recorded on the Data Record Sheet. Resolve any differences.
__E. Every ten nucleotides, number the nucleotide position on the membrane’s page protector or photocopy so that you can easily find a position at a later time.
__F. If you cannot read the nucleotide at a certain position, either because no band is
visible or there are bands of equal intensity in more than one lane, then record as N. If two bands appear at the same position but one band is darker, record the darker nucleotide.
__G. Read the sequence as far up the membrane or photocopy as possible. The bands become increasingly more compressed as you proceed from bottom to top, and at some point it will become too difficult to follow the pattern.
__H. Compare your sequence with those of your lab partners. Do they agree? If not, go back to the membrane and resolve your differences.
__I. Now compare the sequence from your lab group with the sequences obtained by other lab groups that used the same DNA template. Resolve any differences by checking the original membranes.
__J. Using Figure 19, find the junction between the M13mp18 sequencing vector DNA and the human DNA. Mark the junction on your Data Record Sheet. If you do not find the M13mp18 sequence, it probably means that it has been run off the bottom of the gel. Figure 20 shows the process that was used to make the M13 DNA template.
__K. Once you and your lab partners have agreed on the DNA sequence, recopy it onto a pink Data Record Sheet. Also mark the junction between the M13mp18 and the human DNA here as well. Label the sheet with the date, your school, class section, lab group, DNA template number, and the names of all the people in your lab group and their signatures.
Figure 19
. The M13mp18 Vectorprimer strand
5' - CGCCAGGGTTTTCCCAGTCACGA
3' - GCGGTCCCAAAAGGGTCAGTGCTGCAACATTTTGCTGCCGGTCACGGTTCGAACGTACGGACGTCCAGCTGAGATCTCCTAGGGG – 5’
strand of M13mp18
Sequence of the Vector
The DNA we are sequencing is subcloned into the DNA virus called M13mp18.
The DNA of this virus is circular and single-stranded, and its entire 7250
nucleotide sequence is known. The figure above shows the sequence of M13mp18 in
the region right next to the human DNA, as well as the sequence of the primer we
used. The data that you have just analyzed probably contains some of the M13mp18
sequence. Use the information provided here to identify M13mp18 sequence and the
human sequence in your sequencing data.
Figure 20.
How was the template subcloned?
|
![]() |
|
|
|
|
|
4. E. coli bacteria were infected with the recombinant M13. Bacteria producing different recombinant M13 viruses were selected. M13 was grown from each infected bacteria. The M13 was purified from the supernatant (single stranded). |
|
High School Human Genome Program Data Record Sheet – Draft Version
Student Name: _________________________________ Date: ____________________
School: _______________________________________ DNA Template: ____________
Class Section: ______________ Lab Group: __________
1 10 20 30
31
40 50 6061 70 80 90
91 100 110 120
121 130 140 150
151 160 170 180
Comments: _________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________
High School Human Genome Program Data Record Sheet - Final Version
(Please copy on pink paper)
Student Name: _________________________________ Date: ____________________
School: _______________________________________ DNA Template: ____________
Class Section: ______________ Lab Group: __________
Student Names: Student Signatures:
_______________________________ _______________________________
_______________________________ _______________________________
_______________________________ _______________________________
_______________________________ _______________________________
1 10 20 30
31
40 50 6061 70 80 90
91 100 110 120
121 130 140 150
151 160 170 180
Comments:
Day 5: Building the Big Picture--DNA Assembly and BLAST Search
Now that you have sequenced a piece of DNA, what are you going to do with your data? The next step is to carry out a DNA assembly. The assembly is the process of fitting together the different DNA fragments that have been sequenced by finding overlaps in their nucleotide sequences. The larger pieces of contiguous sequence formed by joining two or more DNA fragments are called "contigs". We use a computer program called Sequencher to do this part of the experiment. To help you understand what the computer is doing, complete the activity called "Modeling the Assembly of DNA Fragments" in the Student Activities section.
How can you learn more about the DNA you have sequenced? One way is to do a sequence comparison with all the known DNA sequences that have been submitted to public databases. This information can be accessed through an Internet-based program called BLAST, which is maintained by the National Center for Biotechnology Information (NCBI). You can access BLAST through a link on our High School Human Genome Program web site (http://hshgp.genome.washington.edu). Directions are given below.
DNA Assembly
This part of the experiment requires a computer- either a MacIntosh or a PC, and it should be done in a computer lab so there is one computer for every two students. Prior to the class, the teacher needs to install Sequencher and the folder of student datafiles for the nicotine project onto every computer. These materials are available on the program web site (http://hshgp.genome.washington.edu). From the home page, go to Teacher Resources, and then select Software/Data Download area. From this page you can download Sequencher and our current student datafiles.
To download Sequencher, click on either the Windows 95/NT version or the MacIntosh version. MacIntosh users will also need the program, Stuffit, which can also be downloaded from this page. After you click on the appropriate version of Sequencher, you will see an icon on your desktop labeled SequencherTM Demo Installer. When you double click on this icon, it will open a window for installing the program. Click the "install" button. You will get a message that says the software was successfully installed. The program folder will either be placed on your desktop or in the hard drive. To use Sequencher, you will need to open the file labeled "SequencherTM 3.0.1 Demo. Because this is a demo version, the user cannot print or save results, but can use all other functions of the program.
To download student data, click on the appropriate version of manual and automated data in the data table on the web site (Windows 95/NT or MacIntosh). Two folders will appear on your desktop, labeled nicotine_a_(date) Folder and nicotine_m_(date) Folder. For convenience, you should create a new folder on your desktop and place the Sequencher demo folder and the two folders of student data into it.
Step I: Making a folder of your class’s DNA sequence files
__A. Create a new folder and label it with your class name and the date. The DNA sequences from each of the lab groups in your class will be entered into separate datafiles in this one folder.
__B. For each DNA sequence, open a new Word document and type in the nucleotide sequence. Do not put in any spaces or returns. Save the data as a Simple Text file and use the DNA data file name as the name of the file. Save the file to the class folder.
__C. Load this folder onto all the computers that will be used for the assembly.
Step II: Assembling the data
Your computer should have three folders on its hard disk, the Sequencher Demo folder, a folder called "good nicotine sequences", and the folder of your class data.
__A. Within the Sequencher Demo folder, click on "Sequencher 3.0.1 Demo" to start up the program. As this is a demo version of the software, it is not possible to save or print assemblies, so all assemblies must be viewed on-screen.
__B. When Sequencher starts up, the assembly window appears. You are now ready to import the two folders of data files and assemble them. To import student data, go to the tool bar and chose File->Import & Export->Import Folder of Sequences. Select one of the data folders (either "good nicotine sequences" or the folder of your class data) and choose "Open." The file names contained within that folder will appear in the window. Click "Open" once again to confirm.
__C. Sequencher will then prompt you to make sure you wish to import the entire folder. Choose "Import All Files in Folder." Each student data file will be imported into the Sequencher window. Repeat these steps to import the other folder of data.
__D. Select all the files in the window by holding down the Apple key and the 'A' key. The selected files will appear in blue.
__E. To start the assembly process, simply click on "Assemble Automatically" at the top of the window. It may take some time for your computer to complete the analysis. Once it is finished, you will see files in the analysis window with names starting with "Contig." These are the assembled DNA fragments.
__F. To view a contig, double-click on the small icon to the left of the contig name. This will open the 'overview' window. An example is shown in Figure 21. In this view, each horizontal line represents one DNA sequence (manual or automated). The overview gives you a general idea of how the different DNA fragments overlap with each other to cover the contig. Important features of the sequence are marked by red and green symbols. A legend appears at the bottom of the window to assist you in interpreting your data.
__G. Click on the 'bases' button in the upper left-hand corner of the window. A different view will appear that shows the raw sequences of each fragment making up the contig. Below the raw data there is a "consensus sequence", the sequence that has the best agreement with each of the DNA fragments in the assembly. There are symbols under some of the nucleotides in the consensus to indicate where a disagreement occurs. The large dot (· ) indicates that one or more of the sequences do not agree with the consensus at this nucleotide. A plus sign (+) indicates that there is at least one N in the raw data at this nucleotide.
Figure 21.
Overview window.__H. How well does your sequence agree with the consensus sequence? First, you need to find your sequence. Click on the first contig to open it. Scroll down the sequence names on the left-hand side until you find your sequence. Highlight your sequence name by clicking on it once (it will be highlighted in blue). Now use the scroll keys at the bottom and right-hand side of the screen to find your sequence (it will line up with its name). If you don’t find your sequence in the first contig, check the others. If your sequence doesn’t fit in any of the contigs, it will appear as a single file at the bottom of the list of contigs.
__I. To check the quality of your data, scroll across your fragment, noting whether there are any disagreements with the consensus. If there is a disagreement, look at your membrane to make sure you read the sequence correctly. Did you make an error reading the sequence? If so, you can change your sequence on the assembly. The changed nucleotide will be bright pink to show that it has been changed by the editor. This will not change the sequence in the original datafile- to do that you need to open that file and change it directly.
__J. The summary view provides a slightly different view for comparing your sequence to the others in the contig. First, highlight your sequence by clicking on it once. Then select "summary". Your sequence will be highlighted in this view. Although it is easier to see, you cannot edit from this view.
__K. Now scroll through each of the contigs to see how well the data agrees. What do you think about the quality of the data we have collected so far? Are there any areas where you think we need to do more sequencing? Why?
BLAST Search
BLAST (Basic Local Alignment Search Tool) is a software tool that is used to determine whether a particular DNA or protein sequence matches with any other DNA or protein sequence in one of several public databases. It can be accessed through the Internet at the web site of the National Center for Biotechnology Information (NGBI) at http://www.ncbi.nlm.nih.gov/BLAST or through a link at our HSHGP web site (http://hshgp.genome.washington.edu). In this exercise, you will use BLAST to discover more about the piece of DNA you have sequenced. This part of the experiment is best done in the school computer lab with two students working at each computer.
__A. Go to the BLAST web site. Select Overview if you are interested in learning more about this program.
__B. Go back to the BLAST site and select Basic BLAST Search under BLAST 2.0. The screen you see looks like Figure 22. The legend to Figure 22 explains what each of the boxes means (read before going on to Step C).
Figure 22
. BLAST search window.__C. Enter your sequencing data into the box provided by cutting from your Simple Text file and pasting into the box. Then go to the beginning of your sequence and hit return to create an empty line. You are going to put the name of your template on this line. Type ">" followed by the name of your template. This is called FASTA format, and it should look like this:
>student file
aagtggctccgtagctactagctaatcgtacctag
__D. Hit Search to submit your data. The screen will give you an estimate of how long your search will take. Hit Format results to view your results.
__E. Figures 23-25 show an example of a BLAST search result. The results are presents in three different ways. The colored chart (Figure 23) shows the query sequence as a bar across the top and then uses color-coded bars to show significant regions of overlap with other sequences.
Figure 23.
Chart depicting alignments obtained from a BLAST search.Under this chart is a list of sequences producing significant overlaps (Figure 24).
Figure 24. List of sequences that produce significant overlap with the query sequence. Each line represents a different sequence, starting with the best match. The first column indicates the database where the match was found. Possible databases are Genbank (gb, located in Bethesda, MD), EMBL(emb, located in Europe), DDBJ (dbj, located in Japan), and PDB (pdb, located in New York). The second and third column show numbers that can be used to access the sequence and associated information in the databases. If the third column looks word-like, this sequence has probably been found to be associated with a particular gene locus. Note that the first/second/third columns are hot-linked. If you click on them you can see the actual database record for this matching sequence. The Score and E value are estimates of how strong the match is. The better the match, the higher the score and the lower the E value.
The third section (Figure 25) shows the sections of the query sequence that align with each of the sequences listed above. For any sequence in the list above, you can go directly to the sequence alignment by clicking on its score on the right.
In this section, the query sequence is aligned with the subject sequence in the region(s) of overlap. A line is drawn between the perfectly matched nucleotides.
Figure 22. Example of an alignment from a BLAST search.
__F. Look at the search results for your DNA sequence. Did you find any
matches? Are any of the matches to the b 2 subunit of
the nicotinic acetylcholine receptor? (The b 2
subunit is also called ChRNB2.) Do you see any patterns in the different
sequences that align with your sequence?
DNA Sequencing: Student Activities
QUESTIONS FOR UNDERSTANDING
Directions: Answer the questions in the spaces provided.
Day 1. DNA Synthesis
1) Explain the role of each of the following components during DNA synthesis. Indicate where each component is on the diagram or draw it if it is not present.
(a) DNA template
(b) Primer
(c) Deoxynucleotides
(d) DNA polymerase
2) Use a diagram to show what is occurring at the three different temperatures during thermal cycling.
95° C 45-50° C 70-72° C
Extension: Understanding experimental design.
3) Our primer was 23 nucleotides long. Suggest four features that are important for the selection of a DNA primer for a DNA sequencing experiment.
Day 2, Electrophoresis
1) Name two gel substances that are commonly used for electrophoresis. What sizes of DNA fragments can be resolved on each type of gel?
2) During the running of the sequencing gel, DNA is denatured.
What does ‘denatured’ mean?
Why does the DNA need to be denatured when it is running on a sequencing gel?
How is DNA kept in the denatured form as the gel runs?
3) Why did we transfer DNA from the polyacrylamide gel to the nylon membrane?
Day 3, Detection
1) What is the role of each of the following molecules in the DNA detection technique used in this experiment?
(a) Biotin
(b) Streptavidin
(c) Alkaline Phosphatase
(d) Blocking Solution
(e) Color Solution
2) What is the advantage of using this staining technique instead of attaching a colored dye directly onto the DNA primer?
Extension: Understanding experimental design
3) At the end of color development, Stop Solution is added to the trays containing the membranes. How might Stop Solution work? Give two hypotheses.
Day 4, Analysis
1) What is each band in the "T" lane of the sequencing gel, exactly?
2) Use a diagram to explain why we look for M13 DNA at the bottom of the membrane.
3) Provide explanations for the following experimental results:
(a) No bands are visible anywhere on the membrane.
(b) No bands are visible in one lane of the membrane.
(c) Bands are visible at the same position across all four lanes of the membrane.
(d) Severe blotching on the membrane makes it hard to read.
4) When we read a DNA sequence from the bottom to the top of a membrane,
Are we reading the newly-synthesized DNA, or the template strand?
What direction are we reading on the DNA strand, 5' to 3' or 3' to 5'?
Why is it important to always read and record the sequence in the same direction?
5) A commonly asked question is "How do we know that every possible nucleotide will be represented in our sequencing ladder?" Convince yourself that there will be DNA bands at every possible position on the gel by doing the following set of calculations:
Calculate the maximum number of DNA molecules that can be synthesized in each reaction. Hint: How many DNA template molecules are in each reaction? (the concentration is 0.11 pmol/m l and the volume used is 6 m l). How many primer molecules are in each reaction? (concentration is 0.2 pmol/m l and volume is 4 m l). Since we do a total of 10 cycles, what is the theoretical maximum number of new DNA molecules in each reaction tube? (Think about which reagent will be limiting, the primer or the template.)
How many of these newly synthesized DNA molecules were loaded in each lane of the gel? Hint: What proportion of your total reaction did you load on the gel?
How many DNA molecules are there in each band on the gel? (Assume that there is the same number in each band. The DNA template is 8000 nucleotides long, so there could be up to 8000 bands.)
6) Discuss how a membrane would be affected by each of the following scenarios:
A lab team forgets to heat and ice their DNA samples prior to loading the gel.
Dideoxynucleotide mixtures are mistakenly used that contain dideoxynucleotides at a much higher ratio (1:1), for instance, instead of the correct 1: 9 ratio. What about a lower ratio like 1: 999?
A lab team accidentally loads both their A and C tube mixtures into the same lane on the sequencing gel.
7) The figure below shows a part of an assembly file for some of our nicotine receptor data. The column at the left lists the names of the DNA sequence files. To the right, the corresponding nucleotide sequences are lined up. The sequence across the bottom of the screen is called the consensus sequence. This is sequence that has the best agreement with all of the data files in this region.
What do the symbols · and + below the consensus sequence mean?
Do you think we have good quality data in this region? Explain.
Suggest two things that we could do to improve the quality of the data in this region.
8) The first 114 nucleotides of exon 5 of the human b 2 subunit of the nicotinic acetylcholine receptor were submitted to BLAST to search for matches with other DNA sequences (Query sequence shown below).
Query Sequence:
>exon 5 of human nicotinic acetylcholine receptor beta 2 subunit
gctgacggcatgtacgaggtgtccttctattccaatgccgtggtctcctatgatggcagcatcttctggctgccgcctgccatctacaagagcgcatgcaagattgaagtaaag
A table summarizing the results of the search is shown below.
Data Table for Question 8
|
Sequences with Significant Alignment from BLAST Search |
Score (bits) |
E value |
|
|
1 |
H. sapiens mRNA for nicotinic acetylcholine receptor beta 2 subunit precursor |
226 |
8e-58 |
|
2 |
Mus musculus (mouse) neuronal nicotinic acetylcholine receptor beta 2 gene |
172 |
1e-41 |
|
3 |
Rattus rattus nicotinic acetylcholine receptor beta2 subunit mRNA |
157 |
6e-37 |
|
4 |
Chicken nicotinic acetylcholine receptor non-alpha gene exon 5 |
113 |
8e-24 |
|
5 |
H. sapiens mRNA for nicotinic acetylcholine receptor beta 4 subunit precursor |
65.9 |
2e-09 |
|
6 |
Chicken nicotinic acetylcholine receptor gamma subunit gene |
58.0 |
4e-07 |
|
7 |
Rat neuronal nicotinic acetylcholine receptor-related protein beta 4 gene exon5 |
50.1 |
1e-04 |
|
8 |
Goldfish GF beta-2 mRNA for neuronal nicotinic acetylcholine receptor |
48.1 |
4e-04 |
|
9 |
Torpedo californica (ray) mRNA for acetylcholine receptor gamma subunit |
48.1 |
4e-04 |
|
10 |
Mouse mRNA for nicotinic acetylcholine receptor gamma |
42.1 |
0.026 |
|
11 |
H. sapiens gene fragment for the acetylcholine receptor gamma subunit |
42.1 |
0.026 |
|
12 |
R. norvegicus (rat) gene for acetylcholine receptor gamma subunit |
42.1 |
0.026 |
|
13 |
Rice (O. sativa) gene for proliferating cell nuclear antigen |
36.2 |
1.6 |
|
14 |
M. musculus (mouse) glucose transporter 2 mRNA |
36.2 |
1.6 |
|
15 |
G. gallus (chicken) nicotinic acetylcholine receptor alpha 2 gene exon 5 |
36.2 |
1.6 |
Using the data in the table, answer the following questions:
What happens to the Scores and E values as you move down the table of sequences with significant alignment? Note: Some E values are expressed in exponential notation. For example, an E value of 8e-58 means 8x10-58, a very small number.
Do you notice any patterns in the descriptions of the sequences with significant alignment as you move down the list from 1 to 15 (i.e. Which organisms are represented? What subunits does the query sequence match?)?
The figure on page 53 shows the aligned nucleotide sequences for sequences 1-15. What general trends do you observe as you move down the sequences (i.e. down the page)?
How do the different nucleotide sequences translate into amino acid sequences? To answer this question, follow these steps:
i. Group the nucleotides in triplets by drawing a vertical line after every three nucleotides. Based on other researchers’ work, we know that the correct reading frame is obtained by starting at the first nucleotide in the sequence given.
ii. Using a genetic code table, write the amino acid sequence for the query sequence above its nucleotide sequence. Please note that the DNA sequences given hear are the same as the mRNA sequence that is coded by this sequence. Thus, the first codon in this sequence is GCT.
iii. Scan the nucleotide sequences of all the matching sequences and identify any differences (these are underlined in the figure). Write the amino acid that corresponds to each of the differing triplets.
iv. What patterns do you observe? Does every nucleotide change result in an amino acid change? How many nucleotide changes do you see? How many amino acid changes do you see? Comment on the kinds of amino acid changes you see (hint: are there similarities in the physical characteristics of the original and substituted amino acids?) What do your observations tell you about the effects of mutations on protein evolution?
Aligned Sequences
Query: gctgacggcatgtacgaggtgtccttctattccaatgccgtggtctcctatgatggcagcatcttctggctgccgcctgccatctacaagagcgcatgcaagattgaagtaaa
1: gctgacggcatgtacgaggtgtccttctattccaatgccgtggtctcctatgatggcagcatcttctggctgccgcctgccatctacaagagcgcatgcaagattgaagtaaa
2 gctgacggcatgtacgaagtgtccttctattccaatgctgtggtctcctatgatggcagcatcttttggctaccgcctgccatctacaagagcgcatgcaagattga
3: gctgacggcatgtacgaagtctccttctattccaatgctgtggtctcctatgatggcagcatcttttggctaccacctgccatctacaagagtgcatgcaagattga
4: gacgggatgtacgaggtctccttctactccaacgccgtcatctcctacgacggcagcatcttctggctgccccccgccatctacaagagcgcgtgcaagat
5: tggctgccccctgccatctacaagagcgcctgcaagattga
6: tgatggcagcatctactggctgccccctgccatctac
7: tggctgccccctgctatctacaagagtgcctgcaagattga
8: ttctggctccctcctgccatctacaagagcgc
9: tggtctacaatgatggcagcatgtactggctgcctcctgccat
10: atctactggctgccgcctgccatc
11: atctactggctgccgcctgccatct
12: atctactggctgccgcctgccatct
13: ctatgattgtagcatcttctggctgc
14: ccaatgccgtggcctcctatga
15: gccatctacaagagctcatgca
Modeling DNA Sequencing with Pop-it Beads
This exercise simulates three aspects of DNA sequencing: The synthesis of DNA fragments ending in chain terminators, the separation of these fragments by gel electrophoresis, and reading the sequence. Paper strips represent the DNA template and primer, and pop-it beads are used to represent the nucleotides being added. Some of the pop-it beads are missing the protruding end, and these beads represent the chain terminators, which are missing their 3' OH groups.
Materials for each student group (3-4 students)
4 copies of the template and primer sheet. (Teachers may need to adjust size with a
photocopy machine until the spacing of typed letters fits pop-it bead dimensions.)
1 box of pop-it beads, containing 40 each of red, blue, yellow and green beads (one color consists of 30 normal beads and 10 modified beads). The box represents one of the reaction mixes used on Day 1 of Sequencing.
- scissors
- scotch tape
The color code to the nucleotides (beads) is: A = green, C = blue, G = yellow, T = red.
Step I. DNA Synthesis with Chain Terminators
1. Cut out your primer and template strands. Write your group number on the backs of all the primers (this facilitates a rapid conclusion to the activity).
2. Anneal (match) each paper primer to a paper template strand at the complementary sequence. Tape it in place, using a small piece of tape to represent the collective hydrogen bonds.
3. Now play the role of DNA polymerase. Elongate a primer by adding nucleotides (pop-it beads) that are complementary to those on the template strand. Follow the color code above. Bond (tape) the first bead to the primer’s free 3˘ OH end at the bead’s 5˘ phosphate (hole). Continue adding nucleotides (pop-it beads) until you reach a dideoxy-bead, or until the end of the template is reached. When you select a bead from your termination mix, try to do it randomly, so that you are not deliberately choosing either the normal or the modified bead. Elongate a second primer in the same fashion. Make as many DNA fragments as possible in the time allotted.
Step II. Denaturing Gel Electrophoresis
You and your classmates are going to arrange your DNA fragments on a table in the pattern that you would expect to see if you had separated real DNA fragments on a sequencing gel.
1. Use tape to label one end of the table "top of the gel" and the other end "bottom of the gel." At the top also mark the position of the four lanes A, C, G, and T. Along one side of the gel, place a strip of tape labeled "fragment length" with the numbers 1 to 20 spaced evenly from the bottom to the top. Use a LARGE surface for your "gel" so that the scale can be as large as possible.
2. Denature (separate) the DNA template strands from the elongated primer strands by cutting the hydrogen bonds (tape) that hold them together. Do not sever the covalent bond (tape) holding primer to the rest of the added nucleotides (beads).
3. Place the elongated primers on the "gel" in the appropriate lane and position (line them up with the numbers on the side). If you have more than one fragment of a certain size, clump them together in a tight "band."
Step III. Reading the Sequencing Gel
Notice that the fragments are spread out with the smallest near the bottom and the largest at the top. Each fragment should have a primer on one end and a dideoxy bead at the other (except some of the 20-mers at the top of the gel), and there should be at least one fragment at each position between 5 and 20 if enough primers have been extended. To read the gel:
1. Identify the smallest "band" (it should be at position 5). Which lane is it in: A, C, G, or T? If the lane is labeled "A" then this band corresponds to an "A" in the chain you are sequencing.
Now move up the band pattern to the next lowest band (it can be in any of the four lanes. What lane is it in? This is the next nucleotide in the sequence.
Continue until the top of the gel is reached. Why is this kind of gel often called a "sequencing ladder?"
Concluding the activity
Reclaim your group’s DNA fragments from the table-top gel. Take them apart entirely, returning the separate nucleotides (beads) to their box minus any bits of scotch tape. Discard primers.
Figure 13
. Template and Primer Sheet
Modeling the Assembly of DNA Fragments
Materials:
Scissors, to cut out DNA fragments below; tape to join fragments
Directions:
You have just sequenced a portion of one of thousands of small pieces of the DNA segment that our high school collaboration is sequencing. In our classroom experiment, we enter our sequencing reads into a computer, using the Sequencher software. The assembly program enables us to put all the small pieces together. It does this by finding overlap in the sequences of the different fragments. In this activity, you will be the computer and will look for overlaps in the following five fragments.
Remember that in our actual sequencing project we have thousands of smaller fragments, and either strand of the original sequence may be present. In addition, the matching sequences on different fragments may vary because of sequencing errors. Does this help you appreciate the power of computers in a project of the scale of the Human Genome Project?
Cut out each of the five DNA fragments below and assemble them by finding the overlap in the sequence. Tape in place.
5´ CAATCAGAAGACTCGCTAGAAGAGGTGGTGTCAAGAGAATCTCATCCCTCAT 3´
5´ AATTAAAATGGCCGGAAGAGGTAAAGTTGGAAAAGGATACGGAAAGGTTGGTGCTAAGAGACACACCAAGAAA 3´
5´ GATTCAGTCACCTACACTGAACACGCCAAGAGAAAGACCGTCACTGCTCTCGACGTCGTCTACGCCCTCAAGAGACAAGGTAGAAC 3´
5´ AAAGGTTGGTGCTAAGAGACACACCAAGAAATCACTCAAGGAGACCATCATGGGCATCACCAAGCCAGCAATCAGAAGACTCGCTAGAAGAGGTGGT
5´ TCCCTCATCTATGAGGAGACCAGAAACGTCCTAAGATCATTCCTCGAGAACGTTATCAGAGATTCAGTCACCTACACTGAACACGCCAAGAGAAAGACC
Finding Open Reading Frames
Once we have sequenced a segment of DNA, we are usually interested in finding out if it codes for a protein. Although we cannot tell from just the sequence whether that DNA is translated into a protein inside the cell, we can test for its potential to code for a protein by looking for open reading frames.
1. Protein synthesis. To understand open reading frames, we should first review how information contained in a DNA sequence is translated into a protein. The basic steps are listed below.
(a) Transcription: Inside a cell, one of the DNA strands in a gene is copied into a complementary RNA strand by an enzyme called RNA polymerase, shown in Figure 14. RNA is similar to DNA, except it is single stranded, it is shorter, its nucleotide subunits contain a ribose sugar instead of a deoxyribose sugar, and the base uracil is used in place of thymine. The RNA strand copied from the DNA is called the primary transcript.

Figure 14
. Transcription. (reproduced with permission from "DNA Science, A First Course in Recombinant DNA Technology" by David A. Micklos and Greg A. Freyer, Cold Spring Harbor Laboratory Press, 1990).
(b) Post transcriptional processing: After transcription, chemical modifications are made to both ends of the primary transcripts to protect them from degradation. In eukaryotic cells another kind of processing occurs called RNA splicing. In this process many large segments of the primary RNA transcript are cut out, and the segments on either side are joined at their ends, or spliced (see Figure 15). The segments that are removed are called introns and the segments that are kept are called exons. Often the total length of introns in a primary transcript is far longer than that of the exons.

Figure 15
. Transcription and Translation. (reproduced with permission from Alberts, Bruce, Dennis Bray, Julian Lewis, Martin Raff, Keith Roberts and James D. Watson (1994). Molecular Biology of the Cell. New York; Garland Publishing, Inc.)(c) Translation: As depicted in Figure 15, the processed strand of RNA, called messenger or mRNA, is transported to the cytoplasm. Here, the nucleotide sequence is translated into a chain of amino acids at the ribosome (see Figure 16). The sequence of the mRNA is read (starting near its 5' end) in groups of three nucleotides called codons. Each codon represents one of the twenty amino acids. The first codon to be read is usually AUG (called the start codon), which codes for the amino acid methionine. Once this sequence has been read and methionine is brought into position, the next codon is read and the corresponding amino acid is joined to the methionine. The chain is finished when the ribosome reaches one of three stop codons (UAA, UAG, or UGA), which results in the termination of protein synthesis.

Figure 16
. Translation of RNA into protein. (reproduced with permission from "DNA Science, A First Course in Recombinant DNA Technology" by David A. Micklos and Greg A. Freyer, Cold Spring Harbor Laboratory Press, 1990).2. Searching for Open Reading Frames
Open reading frames, or ORFs, are stretches of DNA sequence that lack stop codons, giving them the potential to code a protein. We look in the DNA sequence for certain features that we expect to find in an mRNA. This process is like reading a message that has no capitals, spaces or punctuation and trying to decipher the meaning. ORFs are fairly easy to identify in prokaryotic DNA because there are no introns, so the sequence of an mRNA and the DNA that codes for it are the same.
(a) First, we arbitrarily start to read the message at one position near the 5' end of the sequence, marking off the sequence with "words" of three letters. This is called the reading frame.
(b) Next, we look for the start of the gene sentence (AUG in the mRNA sequence or ATG in the corresponding DNA sequence).
(c) Finally, we look for the end of the sentence (the period), which is signaled by one of the three stop codons, UAA, UAG or UGA (read as TAA, TAG, or TGA in the DNA sequence). Since there are usually at least 50 to 100 "words" or amino acids in most proteins (more typically 300 to 400), there should be a long stretch of at least 50 to 100 codons in the message between the start codon and the stop codon.
What if we cannot read a message in this reading frame? Then we try another possibility, shifting one nucleotide to the right before marking off our three letter words. Once again, we search for a start codon followed by a segment of at least 50 to 100 codons, ending with a stop codon. If there is a long enough stretch of sequence without a stop codon, we call it an open reading frame. For any DNA sequence there are a total of six reading frames that need to be checked (three on each strand).
3. Checking for understanding.
Now, let's do an example. We're going to work with the following DNA sequence from a microscopic organism called Tetrahymena, a eukaryote (protist):
5' 3'
AATTAAAATGGCCGGAAGAGGTAAAGTTGGA
TTAATTTTACCGGCCTTCTCCATTTCAACCT
3' 5'
(a) There are six possible reading frames. Let's start by looking at the top strand. First, mark off the nucleotides in sets of three, starting at the first A.
5' 3'
AATTAAAATGGCCGGAAGAGGTAAAGTTGGA
Did you find any start or stop codons in this reading frame?
(b) Now let's shift our reading frame one position to the right and again search for start and stop codons.
5' 3'
AATTAAAATGGCCGGAAGAGGTAAAGTTGGA
(c) Now let's look at the last reading frame on this strand:
5' 3'
AATTAAAATGGCCGGAAGAGGTAAAGTTGGA
Did you find a potential open reading frame? Did you find both start and stop sequences?
(d) Now, search the complementary strand. Remember that we need to read it from right to left and start marking off the codons at the T on the 5' end of the fragment.
TTAATTTTACCGGCCTTCTCCATTTCAACCT
3' 5'
(e) Continue to search the next two reading frames.
TTAATTTTACCGGCCTTCTCCATTTCAACCT
3' 5'
TTAATTTTACCGGCCTTCTCCATTTCAACCT
3' 5'
How many open reading frames did you find in this stretch of sequence?
Concluding Questions
1. Did you have enough data here to know for sure that this Tetrahymena DNA codes for a protein?
2. What other information, besides the presence of one or more ORFs, would be needed to prove that a segment of DNA is in fact a gene?
3. Many eukaryotic genes contain introns. How would you go about identifying the open reading frame in a eukaryotic gene suspected to have introns?
Identifying Variants in the CYP2A6 Gene
The main objective of our sequencing project is to identify genetic variants in the gene called CYP2A6. Many different variants have already been identified, including single nucleotide changes, deletions, and duplications. DNA sequencing is useful for identifying single nucleotide changes. In this activity, you will discover how to recognize a variant with a single nucleotide change.
The DNA template we’re sequencing was made by PCR amplifying small portions of the CYP2A6 gene from genomic DNA isolated from a person’s white blood cells. Since people have two copies of all their genes, our DNA templates are actually mixtures of the PCR products made from the two CYP2A6 genes. If the person whose DNA we are sequencing is homozygous for a particular CYP2A6 allele (i.e. both copies of the CYP2A6 gene are the same) then the DNA template will be a single species. What would you expect if the subject was heterozygous for the CYP2A6 gene?
The following two sequences are portions of two different variants for CYP2A6:
CYP2A6*1:
5’-GGGGAGCGCGCCAAGCAGCTCCGGCGCTTCTCCATCGCCACCCTGCGG-3’
CYP2A6*6:
5’-GGGGAGCGCGCCAAGCAGCTCCAGCGCTTCTCCATCGCCACCCTGCGG-3’
In this activity, you will draw the sequencing ladder that you would expect if the person was 1) homozygous for CYP2A6*1, 2) homozygous for CYP2A6*6, or 3) heterozygous (CYP2A6*1/ CYP2A6*6). First follow the example shown below and then complete the activity for each of the three situations.
Example:
STEP 1. Imagine that you are sequencing the DNA template shown below, using the primer 3’-GGTGGGACGCC-5’.
5’-GGGGAGCGCGCCAAGCAGCTCCGGCGCTTCTCCATCGCCACCCTGCGG-3’
GGTGGGACGCC-5’
Draw the complementary sequence that would be made by replicating the entire DNA template. Fill in the new strand to the end. The first 10 nucleotides have been filled in.
5’-GGGGAGCGCGCCAAGCAGCTCCGGCGCTTCTCCATCGCCACCCTGCGG-3’
AAGAGGTAGCGGTGGGACGCC-5’Step 2. .Draw what the membrane would look like for the complementary sequence. (Don’t forget that you wouldn’t see the primer on the ladder.) In the example below, only the first 10 nucleotides have been shown.
A C G T
Student directions: Follow Steps 1 and 2 in the example for the following three pairs of alleles.
Step 1. Fill in the complementary sequence on this page and draw the resulting sequencing ladders on the following page.
1) Person has two copies of the CYP2A6*1 gene
5’-GGGGAGCGCGCCAAGCAGCTCCGGCGCTTCTCCATCGCCACCCTGCGG-3’
GGTGGGACGCC-5’
5’-GGGGAGCGCGCCAAGCAGCTCCGGCGCTTCTCCATCGCCACCCTGCGG-3’
GGTGGGACGCC-5’
2) Person has two copies of the CYP2A6*6 gene
5’-GGGGAGCGCGCCAAGCAGCTCCAGCGCTTCTCCATCGCCACCCTGCGG-3’
GGTGGGACGCC-5’
5’-GGGGAGCGCGCCAAGCAGCTCCAGCGCTTCTCCATCGCCACCCTGCGG-3’
GGTGGGACGCC-5’
3) Person has one copy of the CYP2A6*1 gene and one copy of the CYP2A6*6 gene
5’-GGGGAGCGCGCCAAGCAGCTCCGGCGCTTCTCCATCGCCACCCTGCGG-3’
GGTGGGACGCC-5’
5’-GGGGAGCGCGCCAAGCAGCTCCAGCGCTTCTCCATCGCCACCCTGCGG-3’
GGTGGGACGCC-5’
Step 2. Now draw what the membranes would look like in each example.
1) Homozygous CYP2A6*1 2) Homozygous CYP2A6*6 3) Heterozygous CYP2A6*1/ CYP2A6*6
A C G T A C G T A C G T
Can a Single Nucleotide Change Affect the Protein That is Made ?
Does the single nucleotide difference in the two alleles, CYP2A6*1 and CYP2A6*6, result in a difference in the CYP2A6 enzyme encoded by them? This activity will answer that question.
During transcription, one strand of the DNA gene is copied to make mRNA. The mRNA is then transported to the cytoplasm, where its nucleotide sequence is translated by the ribosome to make an amino acid chain. Follow the steps below to determine the amino acid sequence of the two CYP2A6 alleles:
Step 1. The diagrams below show the CYP2A6 *1 and *6 genes in their double stranded form. It is known that the bottom DNA strand is copied to make mRNA. Fill in the mRNA sequence that would be made by copying the bottom DNA strand of the CYP2A6*1 and CYP2A6*6 genes.
Step 2. Using the Genetic Code table, write the amino acid sequence that is coded by each gene. Read the nucleotides in threes, starting with the first nucleotide on the left. It may be helpful to draw a vertical line after every third nucleotide to help keep your place. Then write the corresponding amino acids in the spaces below the mRNA sequence.
CYP2A6*1:
5’-GGGGAGCGCGCCAAGCAGCTCCGGCGCTTCTCCATCGCCACCCTGCGG-3’
3’-CCCCTCGCGCGGTTCGTCGAGGCCGCGAAGAGGTAGCGGTGGGACGCC-5’¬
DNA strand that is copied5’-
-------------------------------------------------3’¬ fill in mRNA sequence---___---___---___---___---___---___---___---___ ¬
fill in amino acidsequence
CYP2A6*6:
5’-GGGGAGCGCGCCAAGCAGCTCCAGCGCTTCTCCATCGCCACCCTGCGG-3’
3’-CCCCTCGCGCGGTTCGTCGAGGTCGCGAAGAGGTAGCGGTGGGACGCC-5’¬
DNA strand that is copied5’-
-------------------------------------------------3’¬ mRNA made---___---___---___---___---___---___---___---___ ¬
amino acid chain madeGenetic Code
|
1st position |
2nd position |
2nd position |
2nd position |
2nd position |
3rd position |
|
U |
Phe |
Ser |
Tyr |
Cys |
U |
|
U |
Phe |
Ser |
Tyr |
Cys |
C |
|
U |
Leu |
Ser |
STOP |
STOP |
A |
|
U |
Leu |
Ser |
STOP |
Trp |
G |
|
C |
Leu |
Pro |
His |
Arg |
U |
|
C |
Leu |
Pro |
His |
Arg |
C |
|
C |
Leu |
Pro |
Gln |
Arg |
A |
|
C |
Leu |
Pro |
Gln |
Arg |
G |
|
A |
Ile |
Thr |
Asn |
Ser |
U |
|
A |
Ile |
Thr |
Asn |
Ser |
C |
|
A |
Ile |
Thr |
Lys |
Arg |
A |
|
A |
Met |
Thr |
Lys |
Arg |
G |
|
G |
Val |
Ala |
Asp |
Gly |
U |
|
G |
Val |
Ala |
Asp |
Gly |
C |
|
G |
Val |
Ala |
Glu |
Gly |
A |
|
G |
Val |
Ala |
Glu |
Gly |
G |
Did the single nucleotide change have an effect on the proteins encoded by these two genes? Describe your results.
DNA Sequencing: Teacher Resource Appendices
Appendix 1. Equipment and Supplies
For the class:
1 electric frying pan
2 water baths, OR thermal cycler
3 thermometers
1 high voltage power supply (2000-3000 volts)
2 sequencing electrophoresis apparati with 6% polyacrylamide denaturing gels
1 - 16" x 13" Plexiglass plate
8 - 500 ml beakers for ice buckets
Mini-centrifuge
UV crosslinker
Metal microfuge rack with metal lid and handle (minimum 24 sample spaces)
Boxes of disposable gloves
Boxes of flat microcapillary pipet tips
2 - 16" x 13" pieces of Whatman filter paper
1 roll saran wrap
1 roll aluminum foi
1 roll parafilm
Extra disposable tips
1 class supply kit
2 P-200 automatic pipettors
1 biohazard bag
2.25" x 12" pieces of Hybond N+ hybridization transfer membrane (1 per group)
1 metal thermal cycling rack with lid
For each lab group:
1 lab supply kit (8"x13"x4" box with lid), containing:
1 P-20 automatic pipettor and pipet tips
1 stopwatch
1 thermometer
1 felt marker
1 pencil
0.5 ml microfuge tubes, assorted colors (clear, blue, yellow, red)
1 microtube rack
1 waste tip box
1 round tube rack
1 transfer pipet
1 metal spatula
1 forceps
1 graduated cylinder, 25 ml
In addition, each lab group needs:
1- 3" x 15" tray (Rubbermaid drawer organizer
1- 250 ml graduated cylinder
1- water bottle containing distilled water
1- plastic page protector
Solutions
Day 1 Reagents for thermal cycling protocol
Store these reagents in a –20°C freezer. Remove aliquots for each class just before starting that class. A few minutes at room temperature is permissible, but these reagents should not be left out overnight.
Recipes for A, C, G and T Reaction Mixes for Thermal Cycling\
These recipes use the kit components from the USB Thermo Sequenase Cycle Sequencing kit (USB Product Number US78500). Volumes given are sufficient for one set of forward or reverse reactions per class (four student lab groups).
A Reaction Mix without Enzyme
41.7 m L ddA Termination Mix (purple capped tube)
4.5 m L concentrated reaction buffer
2.4 m L 2.7 m M
biotin-tagged forward or reverse primer (provided by this program)
(48.6 m L total)
C Reaction Mix without Enzyme
41.7 m L ddC Termination Mix (purple capped tube)
4.5 m L concentrated reaction buffer
2.4 m L 2.7 m M
biotin-tagged primer (provided by this program)
(48.6 m L total)
G Reaction Mix without Enzyme
41.7 m L ddG Termination Mix (purple capped tube)
4.5 m L concentrated reaction buffer
2.4 m L 2.7 m M
biotin-tagged primer (provided by this program)
(48.6 m L total)
T Reaction Mix without Enzyme
41.7 m L ddT Termination Mix (purple capped tube)
4.5 m L concentrated reaction buffer
2.4 m L 2.7 m M
biotin-tagged primer (provided by this program)
(48.6 m L total)
Freeze each reaction mix in one 45 m L aliquot for up to seven days in advance (each aliquot is enough for one set of forward or reverse reactions, or 4 student lab groups).
A,C,G,T Reaction Mixes with Enzyme (prepare 1-2 hours before use)
Thaw one set each of forward and reverse A, C, G, and T reaction mixes without enzyme.
Add 3 m L 3.8 units/m L ThermoSequenaseTM DNA polymerase containing thermostable pyrophosphatase. Mix by pipetting gently. Make four 8 m L aliquots of forward reaction mix with enzyme in thin-walled 0.5 mL tubes (use color-coded tubes as described in the student protocol), close lids, and store on ice until your students are ready to use (within 1-2 hours). Repeat for reverse reaction mix.
Day 2
Day 3
Appendix 2. How to Submit Student Data
1. From each lab group, collect the following:
2. Make a record of the classes, lab groups, and students’ names within each lab group for your school.
3. Mail or hand-deliver these items to the Genome Center at your earliest convenience.
Two Letter School Designations
Air Academy High School------------------aa
Ballard High School-------------------------bl
Bates Technical College--------------------ba
Bellevue Community College--------------bv
Bemidji High School------------------------be
The Bush School-----------------------------bu
Camas High School---------------------------ca
Cascade Senior High School-----------------cc
Centralia High School------------------------ce
Chief Sealth High School--------------------cs
Columbia River High School----------------cr
Curtis Senior High School-------------------cu
Davis High School----------------------------da
Denver School of the Arts-------------------sr
Eastlake High School-------------------------el
Eastside Catholic High School--------------es
Englewood High School--------------------ew
Enumclaw High School----------------------en
Evergreen High School ----------------------eg
Evergreen State College ---------------------ec
Framingham High School--------------------fr
Garfield High School-------------------------gf
George Washington High School-----------gw
Gray’s Harbor College-----------------------gh
Hudson’s Bay High School-----------------hb
Inglemoor High School-----------------------im
John Oliver High School---------------------jo
Juanita High School--------------------------ju
Kamehameha Schools------------------------ka
King’s College--------------------------------kc
Lakeside High School ----------------------- ls
Lake Washington High School ------------- lw
Lower Cape Main Regional High School---lc
Marysville-Pilchuck High School-----------mp
Mercer Island High School------------------mi
Montesano High School---------------------mo
Mountain View High School -------------- mv
Mountlake Terrace High School------------mt
Naches High School---------------------------na
Nathan Hale High School ------------------- nh
North Kitsap High School--------------------nk
Olympic College-------------------------------ol
Pierce College-----------------------------------pi
Point Grey High School----------------------pg
Port Angeles High School--------------------pa
Prairie High School----------------------------pr
Redmond High School-------------------------rm
Ridgefield High School------------------------rf
Ridley College----------------------------------rc
Roosevelt High School ---------------------- rv
Sacred Heart Academy-----------------------sh
Saint Stephen’s Episcopal School-----------ss
Sammamish High School -------------------- sa
San Mateo High School----------------------sm
Science for Success---------------------------su
Sheridan High School-------------------------sr
Shorecrest High School ----------------------sc
Shorewood High School -------------------- sw
Skyview High School-------------------------sv
Spokane Falls Community College---------sf
Squalicum High School----------------------sq
St. Michael's University School-------------st
Summer Institute-----------------------------si
Timberline High School --------------------- tl
Vashon Island High School------------------vi
Vancouver, WA Schools---------------------vs
Upward Bound (UW)------------------------ub
UW Undergraduates-------------------------ug
Waubonsie Valley High School------------wv
Western Baptist College---------------------wb
West Seattle High School ------------------ ws
DNA Sequencing
Appendix 3. Automated DNA Sequencing Protocol & Reagents
Background
Please read "How Do We Sequence DNA?" in the Introduction to this section.
In principle, manual and automated sequencing are very similar and follow the same basic steps:
1. Synthesis of DNA fragments that are partial copies of the DNA piece being
sequenced;|
2. Separation of DNA fragments according to size by gel electrophoresis; and
3. Detection of the DNA fragments.
As you'll see below, the main difference is that automated sequencing uses a fluorescent tag on the DNA so that it can be detected automatically. Each step is outlined below
Step 1. DNA Sequencing by Thermal Cycling
Cycle sequencing is very similar to the Polymerase Chain Reaction (PCR). Like PCR, cycle sequencing uses a heat stable DNA polymerase that functions at a high temperature and is resistant to near boiling temperatures for many hours. This process has two main advantages; it requires much less DNA template than other techniques and the high temperatures help to 'melt out' secondary structure in the DNA template (like hairpins) that could otherwise inhibit the DNA polymerase. It is also much easier!
First, all of the components needed for DNA synthesis are mixed in a tube:
For each DNA template being sequenced, we need to prepare only one reaction. Each of the dideoxynucleotides have a different colored fluorescent tag (A is green, C is blue, G is yellow and T is red), so the DNA fragments corresponding to A, C, G or T are all color coded.
DNA synthesis is carried out by incubating the reactions at three different temperatures. First, the reactions are heated to 95°C to break apart hydrogen bonds (i.e. base pairing is disrupted). Then the DNA is cooled to 45-55°C to allow the primer to base pair to the DNA template. Finally, the reactions are switched to 70-72°C, the optimum temperature for the DNA polymerase, and DNA synthesis occurs. After 4 minutes at 70°C, the reaction is cycled through the same three temperatures again, allowing another round of DNA synthesis to occur. Every time the cycle is repeated, a new DNA strand is made. The DNA templates are re-used during each cycle because the 95°C incubation releases the template strands from the newly synthesized DNA strands, making them available to be copied again. Typically we carry out about 35 cycles. At the end of the last cycle, the reactions are cooled to 4°C and then stored at -20° C. Before being sequenced each reaction is purified via ethanol precipitation to remove the unused nucleotides and polymerase molecules.
To make sample preparation easy, the four deoxynucleotides and dideoxynucleotides are pre-mixed with DNA polymerase and reaction buffer by the manufacturer. All we need to do is put some of the reaction mix in a color-coded tube and add our DNA template and a primer, and mix with sterile water and sequencing reaction buffer. A low concentration of DNA template can be used because it is recycled each time. The primer is often 50x more concentrated than the template.
Steps 2 and 3. DNA Separation and Detection
As in manual sequencing, the DNA fragments are separated by gel electrophoresis in a denaturing polymer. The main difference in automated sequencing is that a capillary array is placed inside a light-proof container with a laser detector positioned at the end of the capillaries. The detector is on a slider, so that it can move back and forth across the width of the gel. The entire system is attached to a computer, which coordinates the loading of the reactions, running of the fragments, movement of the detector, and storing and processing of the data collected by the detector.
The polymer that separates the DNA fragments is automatically loaded into the capillaries. Once the computer is programmed with the appropriate sample names, the loading arm takes some of each reaction and loads it into the corresponding capillary. When all the samples are loaded the run is started.
The main difference between automated and manual sequencing is in the detection. In automated sequencing, the colored tags on the DNA fragments are detected by the laser detector at the end of the capillaries. As the DNA fragments migrate past the detector, the detector determines which fluorescent tag is on the fragment and sends a signal to the computer. The detector samples each lane in rapid succession, sending information about all 96 capillaries simultaneously to the computer. This information is integrated and processed by a sequencing software program. The data for each DNA sample is presented as a four color chromatograph at the end of the sequencing run.
PROCEDURE
Check off each step as you complete it.
Pre-experiment setup
_____ Write down your full DNA Template name in your lab notebook.
EXAMPLE: 2A6E1P1S1_F1SC_0501
E1=Exon 1
P1=Primer pair set 1
S1=Subject 1 (the individual whose DNA is being sequenced)
F=forward reaction (use R if you did the reverse reaction)
1=Lab group number (assigned by your teacher)
SC=School code
0501=Date (month and year)
Protocol
_____ 1. Label the top of a purple or orange 0.5 ml tube with your DNA Subject number and Group number. Label orange tubes "F" – you will be using the forward sequencing primer. Label purple tubes with "R" and use the reverse sequencing primer.
_____ 2. Put the following in the appropriate colored tube in the order listed:
|
Sterile water |
4ml |
|
Sequencing Primer |
1ml |
|
BDT Reaction Mix (buffer, deoxynucleotides, dideoxynucleotides, DNA polymerase) |
4ml |
|
DNA Template |
1ml |
|
TOTAL |
10ml |
_____ 3. Close the lids and spin in the centrifuge for a few seconds.
_____ 4. Place your reaction in the thermal cycler. Note the position of your tube in case the label wipes off. When everyone's sample is in place, close the lid.
Cycle sequence, using the following temperatures:
Hold at 95°C 3 minutes
95°C 10 seconds
45°C 10 seconds 35 cycles
70°C 4 minutes
Hold at 4°C indefinitely.
Setting Up and Using the Thermal Cycler
(MJ Research Model PTC-100/60)
5. Collect the sample with a quick spin. Check to make sure that each tube is still clearly labelled.
6. Place samples from the class in a rack and put in a –20°C freezer until your visit to the UW Genome Center.
7. Prior to loading your samples, we will precipitate them to remove the remaining nucleotides and polymerase molecules.
8. Place plate in sequencer and program computer.